United States
Germany
Japan
United Kingdom
China
SF2 (SRSF1) (NM_001078166) Human Untagged Clone
CAT＃: SC315487
SRSF1 (untagged)-Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 2
CNY 3,990.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ASF; SF2; SF2p33; SFRS1; SRp30a |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC315487 representing NM_001078166.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCGGGAGGTGGTGTGATTCGTGGCCCCGCAGGGAACAACGATTGCCGCATCTACGTGGGTAACTTA CCTCCAGACATCCGAACCAAGGACATTGAGGACGTGTTCTACAAATACGGCGCTATCCGCGACATCGAC CTCAAGAATCGCCGCGGGGGACCGCCCTTCGCCTTCGTTGAGTTCGAGGACCCGCGAGACGCGGAAGAC GCGGTGTATGGTCGCGACGGCTATGATTACGATGGGTACCGTCTGCGGGTGGAGTTTCCTCGAAGCGGC CGTGGAACAGGCCGAGGCGGCGGCGGGGGTGGAGGTGGCGGAGCTCCCCGAGGTCGCTATGGCCCCCCA TCCAGGCGGTCTGAAAACAGAGTGGTTGTCTCTGGACTGCCTCCAAGTGGAAGTTGGCAGGATTTAAAG GATCACATGCGTGAAGCAGGTGATGTATGTTATGCTGATGTTTACCGAGATGGCACTGGTGTCGTGGAG TTTGTACGGAAAGAAGATATGACCTATGCAGTTCGAAAACTGGATAACACTAAGTTTAGATCTCATGAG GTAGGTTATACACGTATTCTTTTCTTTGACCAGAATTGGATACAGTGGTCTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001078166 |
| Insert Size | 606 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001078166.1 |
| RefSeq Size | 5668 bp |
| RefSeq ORF | 606 bp |
| Locus ID | 6426 |
| UniProt ID | Q07955 |
| Protein Families | Stem cell - Pluripotency |
| Protein Pathways | Spliceosome |
| MW | 22.5 kDa |
| Gene Summary | This gene encodes a member of the arginine/serine-rich splicing factor protein family. The encoded protein can either activate or repress splicing, depending on its phosphorylation state and its interaction partners. Multiple transcript variants have been found for this gene. There is a pseudogene of this gene on chromosome 13. [provided by RefSeq, Jun 2014] Transcript Variant: This variant (2) includes an alternate segment in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2, also known as ASF-3) has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Vitamin A Metabolite, All-trans-retinoic Acid, Mediates Alternative Splicing of Protein Kinase C ?VIII (PKC?VIII) Isoform via Splicing Factor SC35 *
,null,
The Journal of Biological Chemistry
,PubMed ID 20547768
[SRSF1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC213304 | SRSF1 (Myc-DDK-tagged)-Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 2 |
CNY 2,400.00 |
|
| RC213304L1 | Lenti ORF clone of Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC213304L2 | Lenti ORF clone of Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RC213304L3 | Lenti ORF clone of Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC213304L4 | Lenti ORF clone of Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 2, mGFP tagged |
CNY 4,800.00 |
|
| RG213304 | SRSF1 (tGFP-tagged) - Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 2 |
CNY 4,370.00 |
