RBPJK (RBPJ) (NM_005349) Human Untagged Clone
CAT#: SC313743
RBPJ (untagged)-Human recombination signal binding protein for immunoglobulin kappa J region (RBPJ), transcript variant 1
CNY 7,980.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AOS3; CBF-1; CBF1; csl; IGKJRB; IGKJRB1; KBF2; RBP-J; RBP-JK; RBP-J kappa; RBPJK; RBPSUH; SUH |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_005349, the custom clone sequence may differ by one or more nucleotides
ATGGACCACACGGAGGGCTCGCCCGCGGAGGAGCCGCCTGCGCATGCTCCATCGCCTGGGAAATTTGGTG AGCGGCCTCCACCTAAACGACTTACTAGGGAAGCTATGCGAAATTATTTAAAAGAGCGAGGGGATCAAAC AGTACTTATTCTTCATGCAAAAGTTGCACAGAAGTCATATGGAAATGAAAAAAGGTTTTTTTGCCCACCT CCTTGTGTATATCTTATGGGCAGTGGATGGAAGAAAAAAAAAGAACAAATGGAACGCGATGGTTGTTCTG AACAAGAGTCTCAACCGTGTGCATTTATTGGGATAGGAAATAGTGACCAAGAAATGCAGCAGCTAAACTT GGAAGGAAAGAACTATTGCACAGCCAAAACATTGTATATATCTGACTCAGACAAGCGAAAGCACTTCATG TTGTCTGTAAAGATGTTCTATGGCAACAGTGATGACATTGGTGTGTTCCTCAGCAAGCGGATAAAAGTCA TCTCCAAACCTTCCAAAAAGAAGCAGTCATTGAAAAATGCTGACTTATGCATTGCCTCAGGAACAAAGGT GGCTCTGTTTAATCGACTACGATCCCAGACAGTTAGTACCAGATACTTGCATGTAGAAGGAGGTAATTTT CATGCCAGTTCACAGCAGTGGGGAGCCTTTTTTATTCATCTCTTGGATGATGATGAATCAGAAGGAGAAG AATTCACAGTCCGAGATGGCTACATCCATTATGGACAAACAGTCAAACTTGTGTGCTCAGTTACTGGCAT GGCACTCCCAAGATTGATAATTAGGAAAGTTGATAAGCAGACCGCATTATTGGATGCAGATGATCCTGTG TCACAACTCCATAAATGTGCATTTTACCTTAAGGATACAGAAAGAATGTATTTGTGCCTTTCTCAAGAAA GAATAATTCAATTTCAGGCCACTCCATGTCCAAAAGAACCAAATAAAGAGATGATAAATGATGGCGCTTC CTGGACAATCATTAGCACAGATAAGGCAGAGTATACATTTTATGAGGGAATGGGCCCTGTCCTTGCCCCA GTCACTCCTGTGCCTGTGGTAGAGAGCCTTCAGTTGAATGGCGGTGGGGACGTAGCAATGCTTGAACTTA CAGGACAGAATTTCACTCCAAATTTACGAGTGTGGTTTGGGGATGTAGAAGCTGAAACTATGTACAGGTG TGGAGAGAGTATGCTCTGTGTCGTCCCAGACATTTCTGCATTCCGAGAAGGTTGGAGATGGGTCCGGCAA CCAGTCCAGGTTCCAGTAACTTTGGTCCGAAATGATGGAATCATTTATTCCACCAGCCTTACCTTTACCT ACACACCAGAACCAGGGCCGCGGCCACATTGCAGTGCAGCAGGAGCAATCCTTCGAGCCAATTCAAGCCA GGTGCCCCCTAACGAATCAAACACAAACAGCGAGGGAAGTTACACAAACGCCAGCACAAATTCAACCAGT GTCACATCATCTACAGCCACAGTGGTATCCTAA |
Restriction Sites | Please inquire |
ACCN | NM_005349 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_005349.2, NP_005340.2 |
RefSeq Size | 2388 bp |
RefSeq ORF | 1503 bp |
Locus ID | 3516 |
UniProt ID | Q06330 |
Protein Families | Transcription Factors |
Protein Pathways | Notch signaling pathway |
Gene Summary | The protein encoded by this gene is a transcriptional regulator important in the Notch signaling pathway. The encoded protein acts as a repressor when not bound to Notch proteins and an activator when bound to Notch proteins. It is thought to function by recruiting chromatin remodeling complexes containing histone deacetylase or histone acetylase proteins to Notch signaling pathway genes. Several transcript variants encoding different isoforms have been found for this gene, and several pseudogenes of this gene exist on chromosome 9. [provided by RefSeq, Oct 2013] Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218121 | RBPJ (Myc-DDK-tagged)-Human recombination signal binding protein for immunoglobulin kappa J region (RBPJ), transcript variant 1 |
CNY 3,656.00 |
|
RC218121L1 | Lenti ORF clone of Human recombination signal binding protein for immunoglobulin kappa J region (RBPJ), transcript variant 1, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC218121L2 | Lenti ORF clone of Human recombination signal binding protein for immunoglobulin kappa J region (RBPJ), transcript variant 1, mGFP tagged |
CNY 6,270.00 |
|
RC218121L3 | Lenti ORF clone of Human recombination signal binding protein for immunoglobulin kappa J region (RBPJ), transcript variant 1, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC218121L4 | Lenti ORF clone of Human recombination signal binding protein for immunoglobulin kappa J region (RBPJ), transcript variant 1, mGFP tagged |
CNY 6,056.00 |
|
RG218121 | RBPJ (tGFP-tagged) - Human recombination signal binding protein for immunoglobulin kappa J region (RBPJ), transcript variant 1 |
CNY 5,256.00 |