United States
Germany
Japan
United Kingdom
China
WDR1 (NM_005112) Human Untagged Clone
CAT＃: SC313603
WDR1 (untagged)-Human WD repeat domain 1 (WDR1), transcript variant 2
CNY 5,488.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AIP1; HEL-S-52; NORI-1; PFITS |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_005112, the custom clone sequence may differ by one or more nucleotides
ATGCCGTACGAGATCAAGAAGGTGTTCGCCAGCCTCCCGCAGGTGGAGAGGGGCGTCTCCAAGATCATCG GCGGCGACCCTAAGGGCAACAATTTTCTGTACACCAATGGAAAGTGCGTCATCCTAAGGAACATCGACGA CCACAGCCGCTTTGTCAACTGTGTGCGATTCTCTCCTGATGGGAACAGATTTGCCACAGCCAGTGCTGAC GGCCAGATATACATCTATGACGGGAAGACTGGGGAGAAGGTGTGCGCGCTGGGCGGAAGCAAGGCCCACG ACGGTGGGATTTACGCAATTAGTTGGAGTCCCGACAGCACCCATTTGCTTTCTGCTTCTGGGGACAAAAC TTCCAAGATTTGGGACGTCAGCGTGAACTCCGTGGTCAGCACATTTCCCATGGGCTCCACGGTTCTGGAC CAGCAGCTGGGCTGCCTATGGCAGAAGGACCACCTGCTCAGTGTCTCCCTGTCCGGGTACATCAACTATC TGGACAGAAACAACCCCAGCAAGCCCCTGCACGTCATCAAGGGTCACAGTAAATCGATCCAGTGTCTGAC GGTGCATAAAAACGGCGGCAAGTCCTACATTTACTCTGGGAGCCACGACGGACACATTAATTACTGGGAT TCAGAGACGGGGGAGAACGACTCCTTCGCTGGGAAAGGCCACACGAACCAGGTGTCCAGGATGACCGTGG ATGAGTCGGGGCAGCTCATCAGCTGCAGCATGGACGACACCGTGCGGTACACCAGCCTCATGCTGCGGGA CTACAGCGGACAAGGAGTTGTGAAACTGGACGTTCAGCCAAAGTGCGTAGCCGTCGGCCCCGGGGGATAC GCCGTGGTCGTGTGCATTGGACAGATTGTCCTGCTGAAGGATCAGAGGAAGTGCTTCAGCATCGACAACC CCGGCTACGAGCCCGAAGTTGTGGCAGTGCACCCCGGCGGGGACACGGTGGCAATTGGGGGTGTGGACGG CAACGTCCGCCTGTATTCCATCCTGGGCACCACGCTGAAGGATGAGGGCAAGCTCCTAGAGGCCAAGGGC CCCGTGACCGACGTGGCCTACTCCCACGACGGCGCCTTCCTCGCGGTGTGCGACGCCAGCAAGGTGGTCA CAGTGTTCAGCGTTGCTGACGGCTACTCGGAGAACAATGTTTTTTATGGACACCATGCAAAAATCGTCTG CCTGGCCTGGTCCCCAGACAATGAACACTTTGCCTCCGGTGGCATGGACATGATGGTGTATGTTTGGACC CTGAGTGACCCGGAAACCAGAGTCAAGATCCAAGATGCACACCGGCTGCACCATGTCAGCAGCCTGGCCT GGCTGGACGAGCACACGCTGGTCACGACCTCCCATGATGCCTCTGTCAAGGAGTGGACAATCACCTACTG A |
| Restriction Sites | Please inquire |
| ACCN | NM_005112 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_005112.4, NP_005103.2 |
| RefSeq Size | 2740 bp |
| RefSeq ORF | 1401 bp |
| Locus ID | 9948 |
| UniProt ID | O75083 |
| Domains | WD40 |
| Gene Summary | This gene encodes a protein containing 9 WD repeats. WD repeats are approximately 30- to 40-amino acid domains containing several conserved residues, mostly including a trp-asp at the C-terminal end. WD domains are involved in protein-protein interactions. The encoded protein may help induce the disassembly of actin filaments. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an alternate in-frame segment compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217868 | WDR1 (Myc-DDK-tagged)-Human WD repeat domain 1 (WDR1), transcript variant 2 |
CNY 5,488.00 |
|
| RC217868L3 | Lenti-ORF clone of WDR1 (Myc-DDK-tagged)-Human WD repeat domain 1 (WDR1), transcript variant 2 |
CNY 5,990.00 |
|
| RC217868L4 | Lenti-ORF clone of WDR1 (mGFP-tagged)-Human WD repeat domain 1 (WDR1), transcript variant 2 |
CNY 5,990.00 |
|
| RG217868 | WDR1 (tGFP-tagged) - Human WD repeat domain 1 (WDR1), transcript variant 2 |
CNY 4,470.00 |
