PML Protein (PML) (NM_033247) Human Untagged Clone
CAT#: SC313454
PML (untagged)-Human promyelocytic leukemia (PML), transcript variant 8
CN¥ 6,940.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MYL; PP8675; RNF71; TRIM19 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_033247, the custom clone sequence may differ by one or more nucleotides
ATGGAGCCTGCACCCGCCCGATCTCCGAGGCCCCAGCAGGACCCCGCCCGGCCCCAGGAG CCCACCATGCCTCCCCCCGAGACCCCCTCTGAAGGCCGCCAGCCCAGCCCCAGCCCCAGC CCTACAGAGCGAGCCCCCGCTTCGGAGGAGGAGTTCCAGTTTCTGCGCTGCCAGCAATGC CAGGCGGAAGCCAAGTGCCCGAAGCTGCTGCCTTGTCTGCACACGCTGTGCTCAGGATGC CTGGAGGCGTCGGGCATGCAGTGCCCCATCTGCCAGGCGCCCTGGCCCCTAGGTGCAGAC ACACCCGCCCTGGATAACGTCTTTTTCGAGAGTCTGCAGCGGCGCCTGTCGGTGTACCGG CAGATTGTGGATGCGCAGGCTGTGTGCACCCGCTGCAAAGAGTCGGCCGACTTCTGGTGC TTTGAGTGCGAGCAGCTCCTCTGCGCCAAGTGCTTCGAGGCACACCAGTGGTTCCTCAAG CACGAGGCCCGGCCCCTAGCAGAGCTGCGCAACCAGTCGGTGCGTGAGTTCCTGGACGGC ACCCGCAAGACCAACAACATCTTCTGCTCCAACCCCAACCACCGCACCCCTACGCTGACC AGCATCTACTGCCGAGGATGTTCCAAGCCGCTGTGCTGCTCGTGCGCGCTCCTTGACAGC AGCCACAGTGAGCTCAAGTGCGACATCAGCGCAGAGATCCAGCAGCGACAGGAGGAGCTG GACGCCATGACGCAGGCGCTGCAGGAGCAGGATAGTGCCTTTGGCGCGGTTCACGCGCAG ATGCACGCGGCCGTCGGCCAGCTGGGCCGCGCGCGTGCCGAGACCGAGGAGCTGATCCGC GAGCGCGTGCGCCAGGTGGTAGCTCACGTGCGGGCTCAGGAGCGCGAGCTGCTGGAGGCT GTGGACGCGCGGTACCAGCGCGACTACGAGGAGATGGCCAGTCGGCTGGGCCGCCTGGAT GCTGTGCTGCAGCGCATCCGCACGGGCAGCGCGCTGGTGCAGAGGATGAAGTGCTACGCC TCGGACCAGGAGGTGCTGGACATGCACGGTTTCCTGCGCCAGGCGCTCTGCCGCCTGCGC CAGGAGGAGCCCCAGAGCCTGCAAGCTGCCGTGCGCACCGATGGCTTCGACGAGTTCAAG GTGCGCCTGCAGGACCTCAGCTCTTGCATCACCCAGGGGAAAGATGCAGCTGTATCCAAG AAAGCCAGCCCAGAGGCTGCCAGCACTCCCAGGGACCCTATTGACGTTGACCTGCTGCCT CCTCCAGCCCATGCTCTTACAGGCCCTGCACAGAGTAGCACTCAT |
Restriction Sites | Please inquire |
ACCN | NM_033247 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_033247.2, NP_150250.2 |
RefSeq Size | 1797 bp |
RefSeq ORF | 1308 bp |
Locus ID | 5371 |
UniProt ID | P29590 |
Domains | zf-B_box, RING |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Acute myeloid leukemia, Pathways in cancer, Ubiquitin mediated proteolysis |
Gene Summary | The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bodies where it functions as a transcription factor and tumor suppressor. Its expression is cell-cycle related and it regulates the p53 response to oncogenic signals. The gene is often involved in the translocation with the retinoic acid receptor alpha gene associated with acute promyelocytic leukemia (APL). Extensive alternative splicing of this gene results in several variations of the protein's central and C-terminal regions; all variants encode the same N-terminus. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (8) has multiple differences in the coding region compared to variant 1, one of which results in translational frame-shift. The resulting isoform (8, also known as PML-VII and TRIM19theta) has a distinct C-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220576 | PML (Myc-DDK-tagged)-Human promyelocytic leukemia (PML), transcript variant 8 |
CN¥ 3,656.00 |
|
RC220576L3 | Lenti-ORF clone of PML (Myc-DDK-tagged)-Human promyelocytic leukemia (PML), transcript variant 8 |
CN¥ 5,890.00 |
|
RC220576L4 | Lenti-ORF clone of PML (mGFP-tagged)-Human promyelocytic leukemia (PML), transcript variant 8 |
CN¥ 5,890.00 |
|
RG220576 | PML (tGFP-tagged) - Human promyelocytic leukemia (PML), transcript variant 8 |
CN¥ 4,370.00 |
其它PML Protein产品