MEIS2 (NM_170677) Human Untagged Clone

CAT#: SC313311

MEIS2 (untagged)-Human Meis homeobox 2 (MEIS2), transcript variant a



  "NM_170677" in other vectors (6)

CNY 5,856.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
Rabbit Polyclonal Anti-MEIS2 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CPCMR; HsT18361; MRG1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene ORF within SC113195 sequence for NM_020149 edited (data generated by NextGen Sequencing)
ATGGCGCAAAGGTACGATGAGCTGCCCCATTACGGCGGGATGGACGGAGTAGGGGTTCCC
GCTTCCATGTACGGAGACCCTCACGCGCCGCGGCCGATCCCCCCGGTTCACCACCTGAAC
CACGGGCCGCCGCTCCACGCCACACAGCACTACGGCGCGCACGCCCCGCACCCCAATGTC
ATGCCGGCCAGTATGGGATCCGCTGTCAACGACGCCTTGAAGCGGGACAAGGACGCGATC
TATGGGCACCCGTTGTTTCCTCTGTTAGCTCTGGTCTTTGAGAAGTGCGAGCTGGCGACC
TGCACTCCCCGGGAACCTGGAGTGGCTGGCGGAGACGTCTGCTCCTCCGACTCCTTCAAC
GAGGACATCGCGGTCTTCGCCAAGCAGGTTCGCGCCGAAAAGCCACTTTTTTCCTCAAAT
CCAGAGCTGGACAATTTGATGATACAAGCAATACAAGTACTAAGGTTTCATCTTTTGGAG
TTAGAAAAGGTCCACGAACTGTGCGATAACTTCTGCCACCGATACATTAGCTGTTTGAAG
GGGAAAATGCCCATCGACCTCGTCATTGATGAAAGAGACGGCAGCTCCAAGTCAGATCAT
GAAGAACTTTCAGGCTCCTCCACAAATCTCGCTGACCATAACCCTTCTTCTTGGCGAGAC
CACGATGATGCAACCTCAACCCACTCAGCAGGCACCCCAGGGCCCTCCAGTGGGGGCCAT
GCTTCCCAGAGCGGAGACAACAGCAGTGAGCAAGGGGATGGTTTAGACAACAGTGTAGCT
TCACCTGGTACAGGTGACGATGATGATCCGGATAAGGACAAAAAACGCCAGAAGAAAAGA
GGCATTTTCCCCAAAGTAGCAACAAATATCATGAGAGCATGGCTCTTCCAGCATCTCACA
GTTTATTAA

Clone variation with respect to NM_020149.2
Restriction Sites SgfI-MluI     
ACCN NM_170677
Insert Size 1206 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_170677.4
RefSeq Size 3373 bp
RefSeq ORF 1206 bp
Locus ID 4212
UniProt ID O14770
Protein Families Transcription Factors
MW 43.8 kDa
Gene Summary This gene encodes a homeobox protein belonging to the TALE ('three amino acid loop extension') family of homeodomain-containing proteins. TALE homeobox proteins are highly conserved transcription regulators, and several members have been shown to be essential contributors to developmental programs. Multiple transcript variants encoding distinct isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (a) represents the longest transcript.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...