GNB5 (NM_016194) Human Untagged Clone

CAT#: SC313286

GNB5 (untagged)-Human guanine nucleotide binding protein (G protein), beta 5 (GNB5), transcript variant 2



  "NM_016194" in other vectors (4)

CNY 6,370.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-GNB5 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GB5; gbeta5; IDDCA; LADCI
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_016194, the custom clone sequence may differ by one or more nucleotides
ATGTGTGATCAGACCTTTCTCGTTAATGTATTTGGCTCATGTGACAAATGTTTCAAACAA
CGAGCTCTGAGACCAGTTTTCAAGAAGTCTCAACAACTCAGCTACTGTTCAACATGTGCA
GAAATTATGGCAACCGAGGGGCTGCACGAGAACGAGACGCTGGCGTCGCTGAAGAGCGAG
GCCGAGAGCCTCAAGGGCAAGCTGGAGGAGGAGCGAGCCAAGCTGCACGATGTGGAGCTG
CACCAGGTGGCGGAGCGGGTGGAGGCCCTGGGGCAGTTTGTCATGAAGACCAGAAGGACC
CTCAAAGGCCACGGGAACAAAGTCCTGTGCATGGACTGGTGCAAAGATAAGAGGAGGATC
GTGAGCTCGTCACAGGATGGGAAGGTGATCGTGTGGGATTCCTTCACCACAAACAAGGAG
CACGCGGTCACCATGCCCTGCACGTGGGTGATGGCATGTGCTTATGCCCCATCGGGATGT
GCCATTGCTTGTGGTGGTTTGGATAATAAGTGTTCTGTGTACCCCTTGACGTTTGACAAA
AATGAAAACATGGCTGCCAAAAAGAAGTCTGTTGCTATGCACACCAACTACCTGTCGGCC
TGCAGCTTCACCAACTCTGACATGCAGATCCTGACAGCGAGCGGCGATGGCACATGTGCC
CTGTGGGACGTGGAGAGCGGGCAGCTGCTGCAGAGCTTCCACGGACATGGGGCTGACGTC
CTCTGCTTGGACCTGGCCCCCTCAGAAACTGGAAACACCTTCGTGTCTGGGGGATGTGAC
AAGAAAGCCATGGTGTGGGACATGCGCTCCGGCCAGTGCGTGCAGGCCTTTGAAACACAT
GAATCTGACATCAACAGTGTCCGGTACTACCCCAGTGGAGATGCCTTTGCTTCAGGGTCA
GATGACGCTACGTGTCGCCTCTATGACCTGCGGGCAGATAGGGAGGTTGCCATCTATTCC
AAAGAAAGCATCATATTTGGAGCATCCAGCGTGGACTTCTCCCTCAGTGGTCGCCTGCTG
TTTGCTGGATACAATGATTACACTATCAACGTCTGGGATGTTCTCAAAGGGTCCCGGGTC
TCCATCCTGTTTGGACATGAAAACCGCGTTAGCACTCTACGAGTTTCCCCCGATGGGACT
GCTTTCTGCTCTGGATCATGGGATCATACCCTCAGAGTCTGGGCC
Restriction Sites Please inquire     
ACCN NM_016194
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_016194.3, NP_057278.2
RefSeq Size 3084 bp
RefSeq ORF 1188 bp
Locus ID 10681
UniProt ID O14775
Domains WD40
Protein Families Druggable Genome
Protein Pathways Chemokine signaling pathway
Gene Summary Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. Alternatively spliced transcript variants encoding different isoforms exist. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) has two additional exons at its 5' end, but lacks the 5' portion of its third exon, compared to variant 1. It encodes an isoform (b) containing 42 additional amino acids at its N terminus compared to isoform a. This isoform is also referred to as beta subunit 5L.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...