GNB5 (NM_016194) Human Untagged Clone
CAT#: SC313286
GNB5 (untagged)-Human guanine nucleotide binding protein (G protein), beta 5 (GNB5), transcript variant 2
CNY 6,370.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GB5; gbeta5; IDDCA; LADCI |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_016194, the custom clone sequence may differ by one or more nucleotides
ATGTGTGATCAGACCTTTCTCGTTAATGTATTTGGCTCATGTGACAAATGTTTCAAACAA CGAGCTCTGAGACCAGTTTTCAAGAAGTCTCAACAACTCAGCTACTGTTCAACATGTGCA GAAATTATGGCAACCGAGGGGCTGCACGAGAACGAGACGCTGGCGTCGCTGAAGAGCGAG GCCGAGAGCCTCAAGGGCAAGCTGGAGGAGGAGCGAGCCAAGCTGCACGATGTGGAGCTG CACCAGGTGGCGGAGCGGGTGGAGGCCCTGGGGCAGTTTGTCATGAAGACCAGAAGGACC CTCAAAGGCCACGGGAACAAAGTCCTGTGCATGGACTGGTGCAAAGATAAGAGGAGGATC GTGAGCTCGTCACAGGATGGGAAGGTGATCGTGTGGGATTCCTTCACCACAAACAAGGAG CACGCGGTCACCATGCCCTGCACGTGGGTGATGGCATGTGCTTATGCCCCATCGGGATGT GCCATTGCTTGTGGTGGTTTGGATAATAAGTGTTCTGTGTACCCCTTGACGTTTGACAAA AATGAAAACATGGCTGCCAAAAAGAAGTCTGTTGCTATGCACACCAACTACCTGTCGGCC TGCAGCTTCACCAACTCTGACATGCAGATCCTGACAGCGAGCGGCGATGGCACATGTGCC CTGTGGGACGTGGAGAGCGGGCAGCTGCTGCAGAGCTTCCACGGACATGGGGCTGACGTC CTCTGCTTGGACCTGGCCCCCTCAGAAACTGGAAACACCTTCGTGTCTGGGGGATGTGAC AAGAAAGCCATGGTGTGGGACATGCGCTCCGGCCAGTGCGTGCAGGCCTTTGAAACACAT GAATCTGACATCAACAGTGTCCGGTACTACCCCAGTGGAGATGCCTTTGCTTCAGGGTCA GATGACGCTACGTGTCGCCTCTATGACCTGCGGGCAGATAGGGAGGTTGCCATCTATTCC AAAGAAAGCATCATATTTGGAGCATCCAGCGTGGACTTCTCCCTCAGTGGTCGCCTGCTG TTTGCTGGATACAATGATTACACTATCAACGTCTGGGATGTTCTCAAAGGGTCCCGGGTC TCCATCCTGTTTGGACATGAAAACCGCGTTAGCACTCTACGAGTTTCCCCCGATGGGACT GCTTTCTGCTCTGGATCATGGGATCATACCCTCAGAGTCTGGGCC |
Restriction Sites | Please inquire |
ACCN | NM_016194 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_016194.3, NP_057278.2 |
RefSeq Size | 3084 bp |
RefSeq ORF | 1188 bp |
Locus ID | 10681 |
UniProt ID | O14775 |
Domains | WD40 |
Protein Families | Druggable Genome |
Protein Pathways | Chemokine signaling pathway |
Gene Summary | Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. Alternatively spliced transcript variants encoding different isoforms exist. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) has two additional exons at its 5' end, but lacks the 5' portion of its third exon, compared to variant 1. It encodes an isoform (b) containing 42 additional amino acids at its N terminus compared to isoform a. This isoform is also referred to as beta subunit 5L. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221491 | GNB5 (Myc-DDK-tagged)-Human guanine nucleotide binding protein (G protein), beta 5 (GNB5), transcript variant 2 |
CNY 3,656.00 |
|
RC221491L3 | Lenti-ORF clone of GNB5 (Myc-DDK-tagged)-Human guanine nucleotide binding protein (G protein), beta 5 (GNB5), transcript variant 2 |
CNY 5,890.00 |
|
RC221491L4 | Lenti-ORF clone of GNB5 (mGFP-tagged)-Human guanine nucleotide binding protein (G protein), beta 5 (GNB5), transcript variant 2 |
CNY 5,890.00 |
|
RG221491 | GNB5 (tGFP-tagged) - Human guanine nucleotide binding protein (G protein), beta 5 (GNB5), transcript variant 2 |
CNY 4,370.00 |