C3orf37 (HMCES) (NM_020187) Human Untagged Clone

CAT#: SC313096

C3orf37 (untagged)-Human chromosome 3 open reading frame 37 (C3orf37), transcript variant 2



  "NM_020187" in other vectors (4)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
HMCES Antibody - N-terminal region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C3orf37; DC12; SRAPD1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC313096 representing NM_020187.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTGTGGGCGAACATCCTGTCACTTACCTAGAGATGTTCTCACGAGAGCTTGCGCCTACCAGGATCGG
CGGGGCCAGCAGCGGCTCCCGGAGTGGAGGGACCCTGATAAGTACTGCCCCTCTTACAACAAGAGTCCT
CAATCCAACAGCCCAGTGCTTCTGTCTCGACTGCACTTTGAGAAGGATGCAGACTCATCTGAGCGTATC
ATTGCTCCCATGCGCTGGGGCTTGGTCCCTTCTTGGTTCAAAGAAAGTGATCCTTCCAAGCTGCAGTTC
AATACTACCAACTGTCGTAGTGATACCGTAATGGAGAAACGGTCATTTAAGGTGCCTCTGGGAAAGGGA
AGACGCTGTGTCGTTTTAGCAGATGGATTCTATGAGTGGCAGCGATGTCAGGGAACAAACCAGAGGCAG
CCATACTTCATCTATTTTCCTCAAATCAAGACAGAGAAGTCAGGTAGCATTGGTGCTGCAGATAGTCCT
GAGAACTGGGAGAAAGTCTGGGACAACTGGAGGCTGCTGACAATGGCCGGGATCTTTGACTGCTGGGAG
CCCCCAGAGGGAGGAGATGTCCTGTATTCCTATACCATCATCACAGTGGATTCCTGCAAAGGCTTGAGT
GACATCCACCACAGGATGCCTGCCATATTAGATGGAGAGGAGGCAGTTTCTAAATGGCTTGACTTTGGT
GAAGTCTCAACTCAGGAAGCTCTGAAATTAATCCACCCAACAGAGAACATCACCTTCCATGCAGTCTCT
TCTGTGGTGAACAACTCGCGAAACAACACTCCTGAGTGTCTGGCTCCTGTCGACTTGGTGGTCAAAAAG
GAGCTCAGGGCAAGTGGCAGTAGCCAGAGGATGTTGCAGTGGTTGGCCACAAAGTCACCCAAAAAGGAA
GACTCAAAAACACCTCAAAAGGAAGAGTCAGATGTTCCCCAGTGGTCCAGTCAGTTCCTGCAGAAGAGT
CCACTCCCCACCAAGAGAGGCACTGCAGGACTCCTAGAGCAATGGCTGAAGCGGGAGAAGGAGGAGGAA
CCTGTGGCCAAGCGTCCTTACAGCCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_020187
Insert Size 1065 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_020187.2
RefSeq Size 1638 bp
RefSeq ORF 1065 bp
Locus ID 56941
UniProt ID Q96FZ2
Domains DUF159
MW 40.6 kDa
Gene Summary Sensor of abasic sites in single-stranded DNA (ssDNA) required to preserve genome integrity by promoting error-free repair of abasic sites (PubMed:30554877). Acts as an enzyme that recognizes and binds abasic sites in ssDNA at replication forks and chemically modifies the lesion by forming a covalent cross-link with DNA (PubMed:30554877). The HMCES DNA-protein cross-link is then degraded by the proteasome (PubMed:30554877). Promotes error-free repair of abasic sites by acting as a 'suicide' enzyme that is degraded, thereby protecting abasic sites from translesion synthesis (TLS) polymerases and endonucleases that are error-prone and would generate mutations and double-strand breaks (PubMed:30554877). Acts as a protease: mediates autocatalytic processing of its N-terminal methionine in order to expose the catalytic cysteine (By similarity). Specifically binds 5-hydroxymethylcytosine (5hmC)-containing DNA in stem cells (By similarity). May act as an endonuclease that specifically cleaves 5hmC-containing DNA; additional experiments are however required to confirm this activity in vivo (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...