RASSF1 (NM_007182) Human Untagged Clone

CAT#: SC313020

RASSF1 (untagged)-Human Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant A



  "NM_007182" in other vectors (6)

CNY 5,488.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
RASSF1 mouse monoclonal antibody, clone OTI2B11 (formerly 2B11)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 123F2; NORE2A; RASSF1A; RDA32; REH3P21
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_007182 edited
CAGTCTGGATCCTGGGGGAGGCGCTGAAGTCGGGGCCCGCCCTGTGGCCCCGCCCGGCCC
GCGCTTGCTAGCGCCCAAAGCCAGCGAAGCACGGGCCCAACCGGGCCATGTCGGGGGAGC
CTGAGCTCATTGAGCTGCGGGAGCTGGCACCCGCTGGGCGCGCTGGGAAGGGCCGCACCC
GGCTGGAGCGTGCCAACGCGCTGCGCATCGCGCGGGGCACCGCGTGCAACCCCACACGGC
AGCTGGTCCCTGGCCGTGGCCACCGCTTCCAGCCCGCGGGGCCCGCCACGCACACGTGGT
GCGACCTCTGTGGCGACTTCATCTGGGGCGTCGTGCGCAAAGGCCTGCAGTGCGCGCATT
GCAAGTTCACCTGCCACTACCGCTGCCGCGCGCTCGTCTGCCTGGACTGTTGCGGGCCCC
GGGACCTGGGCTGGGAACCCGCGGTGGAGCGGGACACGAACGTGGACGAGCCTGTGGAGT
GGGAGACACCTGACCTTTCTCAATCTGAGATTGAGCAGAAGATCAAGGAGTACAATGCCC
AGATCAACAGCAACCTCTTCATGAGCTTGAACAAGGACGGTTCTTACACAGGCTTCATCA
AGGTTCAGCTGAAGCTGGTGCGCCCTGTCTCTGTGCCCTCCAGCAAGAAGCCACCCTCCT
TGCAGGATGCCCGGCGGGGCCCAGGACGGGGCACAAGTGTCAGGCGCCGCACTTCCTTTT
ACCTGCCCAAGGATGCTGTCAAGCACCTGCATGTGCTGTCACGCACAAGGGCACGTGAAG
TCATTGAGGCCCTGCTGCGAAAGTTCTTGGTGGTGGATGACCCCCGCAAGTTTGCACTCT
TTGAGCGCGCTGAGCGTCACGGCCAAGTGTACTTGCGGAAGCTGTTGGATGATGAGCAGC
CCCTGCGGCTGCGGCTCCTGGCAGGGCCCAGTGACAAGGCCCTGAGCTTTGTCCTGAAGG
AAAATGACTCTGGGGAGGTGAACTGGGACGCCTTCAGCATGCCTGAACTACATAACTTCC
TACGTATCCTGCAGCGGGAGGAGGAGGAGCACCTCCGCCAGATCCTGCAGAAGTACTCCT
ATTGCCGCCAGAAGATCCAAGAGGCCCTGCACGCCTGCCCCCTTGGGTGACCTCTTGTAC
CCCCAGGTGGAAGGCAGACAGCAGGCAGCGCCAAGTGCGTGCCGTGTGAGTGTGACAGGG
CCAGTGGGGCCTGTGGAATGAGTGTGCATGGAGGCCCTCCTGTGCTGGGGGAATGAGCCC
AGAGAACAGCGAAGTAGCTTGCTCCCTGTGTCCACCTGTGGG
Restriction Sites Please inquire     
ACCN NM_007182
Insert Size 1300 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_007182.4.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_007182.4, NP_009113.3
RefSeq Size 1968 bp
RefSeq ORF 1023 bp
Locus ID 11186
UniProt ID Q9NS23
Domains RA, DAG_PE-bind
Protein Families Druggable Genome
Protein Pathways Bladder cancer, Non-small cell lung cancer, Pathways in cancer
Gene Summary This gene encodes a protein similar to the RAS effector proteins. Loss or altered expression of this gene has been associated with the pathogenesis of a variety of cancers, which suggests the tumor suppressor function of this gene. The inactivation of this gene was found to be correlated with the hypermethylation of its CpG-island promoter region. The encoded protein was found to interact with DNA repair protein XPA. The protein was also shown to inhibit the accumulation of cyclin D1, and thus induce cell cycle arrest. Several alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, May 2011]
Transcript Variant: This variant (A) lacks an in-frame coding segment compared to variant D, resulting an isoform (A) that lacks an internal region, as compared to isoform D.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...