United States
Germany
Japan
United Kingdom
China
HIF1 beta (ARNT) (NM_178426) Human Untagged Clone
CAT＃: SC312979
ARNT (untagged)-Human aryl hydrocarbon receptor nuclear translocator (ARNT), transcript variant 2
CNY 2,400.00
CNY 6,270.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | aryl hydrocarbon receptor nuclear translocator; bHLHe2; dioxin receptor, nuclear translocator; HIF-1beta; HIF1B; HIF1BETA; hypoxia-inducible factor 1, beta subunit; OTTHUMP00000032943; TANGO |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_178426 edited
ATGGCGGCGACTACTGCCAACCCCGAAATGACATCAGATGTACCATCACTGGGTCCAGCC ATTGCCTCTGGAAACTCTGGACCTGGAATTCAAGGTGGAGGAGCCATTGTCCAGAGGGCT ATTAAGCGGCGACCAGGGCTGGATTTTGATGATGATGGAGAAGGGAACAGTAAATTTTTG AGGTGTGATGATGATCAGATGTCTAACGATAAGGAGCGGTTTGCCAGGTCGGATGATGAG CAGAGCTCTGCGGATAAAGAGAGACTTGCCAGGGAAAATCACAGTGAAATTGAACGGCGG CGACGGAACAAGATGACAGCCTACATCACAGAACTGTCAGATATGGTACCCACCTGTAGT GCCCTGGCTCGAAAACCAGACAAGCTAACCATCTTACGCATGGCAGTTTCTCACATGAAG TCCTTGCGGGGAACTGGCAACACATCCACTGATGGCTCCTATAAGCCGTCTTTCCTCACT GATCAGGAACTGAAACATTTGATCTTGGAGGCAGCAGATGGCTTTCTGTTTATTGTCTCA TGTGAGACAGGCAGGGTGGTGTATGTGTCTGACTCCGTGACTCCTGTTTTGAACCAGCCA CAGTCTGAATGGTTTGGCAGCACACTCTATGATCAGGTGCACCCAGATGATGTGGATAAA CTTCGTGAGCAGCTTTCCACTTCAGAAAATGCCCTGACAGGGCGTATCCTGGATCTAAAG ACTGGAACAGTGAAAAAGGAAGGTCAGCAGTCTTCCATGAGAATGTGTATGGGCTCAAGG AGATCGTTTATTTGCCGAATGAGGTGTGGCAGTAGCTCTGTGGACCCAGTTTCTGTGAAT AGGCTGAGCTTTGTGAGGAACAGATGCAGGAATGGACTTGGCTCTGTAAAGGATGGGGAA CCTCACTTCGTGGTGGTCCACTGCACAGGCTACATCAAGGCCTGGCCCCCAGCAGGTGTT TCCCTCCCAGATGATGACCCAGCCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_178426 |
| Insert Size | 2000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_178426.1, NP_848513.1 |
| RefSeq Size | 3563 bp |
| RefSeq ORF | 987 bp |
| Locus ID | 405 |
| Protein Families | Druggable Genome, Transcription Factors |
| Protein Pathways | Pathways in cancer, Renal cell carcinoma |
| Gene Summary | This gene encodes a protein containing a basic helix-loop-helix domain and two characteristic PAS domains along with a PAC domain. The encoded protein binds to ligand-bound aryl hydrocarbon receptor and aids in the movement of this complex to the nucleus, where it promotes the expression of genes involved in xenobiotic metabolism. This protein is also a co-factor for transcriptional regulation by hypoxia-inducible factor 1. Chromosomal translocation of this locus with the ETV6 (ets variant 6) gene on chromosome 12 have been described in leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013] Transcript Variant: This variant (2) lacks several alternate segments, compared to variant 1, that causes a frameshift. The resulting protein (isoform 2) is shorter and has a distinct C-terminus, compared to variant 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217284 | ARNT (Myc-DDK-tagged)-Human aryl hydrocarbon receptor nuclear translocator (ARNT), transcript variant 2 |
CNY 2,400.00 |
|
| RC217284L3 | Lenti ORF clone of Human aryl hydrocarbon receptor nuclear translocator (ARNT), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC217284L4 | Lenti ORF clone of Human aryl hydrocarbon receptor nuclear translocator (ARNT), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG217284 | ARNT (tGFP-tagged) - Human aryl hydrocarbon receptor nuclear translocator (ARNT), transcript variant 2 |
CNY 4,370.00 |
其它HIF1 beta产品
