CBX4 (BC014967) Human Untagged Clone

CAT#: SC312821

CBX4 (untagged)-Homo sapiens, clone MGC:23084 IMAGE:4856728, complete cds



CNY 9,120.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal anti-PC2 antibody
    • 100 ug

CNY 8,025.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms chromobox homolog 4; chromobox homolog 4 (Pc class homolog, Drosophila); hPC2; NBP16; NS5ATP1-binding protein 16; PC2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for BC014967, the custom clone sequence may differ by one or more nucleotides
ATGGAGCTGCCAGCTGTTGGCGAGCACGTCTTCGCGGTGGAGAGCATCGAGAAGAAGCGG
ATCCGCAAGGGCAGAGTGGAGTATCTGGTGAAATGGAGAGGCTGGTCGCCCAAATATAAC
ACGTGGGAACCGGAGGAGAACATCCTGGACCCCAGGCTGCTGATCGCCTTCCAGAACAGG
GAACGGCAGGAGCAGCTGATGGGATATCGGAAGAGAGGGCCGAAGCCCAAACCGCTAGTG
GTGCAGGTGCCTACCTTTGCCCGTCGTTCCAATGTCCTGACCGGCCTCCAGGACTCCTCC
ACTGACAACCGTGCCAAGCTGGATTTGGGCGCGCAGGGGAAGGGCCAGGGGCATCAGTAC
GAGCTCAACAGCAAGAAGCACCACCACCACGCCGTCGGCCTGAATCTCTCCCACGTGCGC
AAGCGCTGCCTCTCCGAGACCCACGGCGAGCGCGAGCCCTGCAAGAAGCGGCTGACTGCG
CGCAGCATCAGCACCCCCACCTGCCTGGGGGGCAGCCCAGCCGCTGAGCGCCCGGCCGAC
CTGCCACCAGCCGCCGCCCTCCCGCAGCCCGAGGTCATCCTGCTAGACTCAGACCTGGAT
GAACCCATAGACTTGCGCTGCGTCAAGACGCGCAGCGAGGCCGGGGAGCCGCCCAGCTCC
CTCCAGGTGAAGCCCGAGACACCGGCGTCGGCGGCGGTGGCGGTGGCGGCGGCAGCGGCA
CCCACCACGACGGCGGAGAAGCCTCCAGCCGAGGCCCAGGACGAACCTGCAGAGTCGCTG
AGCGAGTTCAAGCCCTTCTTTGGGAATATAATTATCACCGACGTCACCGCGAACTGCCTC
ACCGTTACTTTCAAGGAGTACGTGACGGTG
Restriction Sites Please inquire     
ACCN BC014967
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC014967.1, AAH14967.1
RefSeq Size 1578 bp
RefSeq ORF 1578 bp
Locus ID 8535
Domains CHROMO
Protein Families Druggable Genome, Transcription Factors
Gene Summary E3 SUMO-protein ligase which facilitates SUMO1 conjugation by UBE2I (PubMed:12679040). Involved in the sumoylation of HNRNPK, a p53/TP53 transcriptional coactivator, hence indirectly regulates p53/TP53 transcriptional activation resulting in p21/CDKN1A expression. Monosumoylates ZNF131 (PubMed:22825850).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...