TAZ (NM_181312) Human Untagged Clone

CAT#: SC312782

TAZ (untagged)-Human tafazzin (TAZ), nuclear gene encoding mitochondrial protein, transcript variant 3



  "NM_181312" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TAZ mouse monoclonal antibody,clone OTI1B3
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BTHS; CMD3A; EFE; EFE2; G4.5; LVNCX; TAZ; Taz1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC312782 representing NM_181312.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCTCTGCACGTGAAGTGGCCGTTCCCCGCGGTGCCGCCGCTCACCTGGACCCTGGCCAGCAGCGTC
GTCATGGGCTTGGTGGGCACCTACAGCTGCTTCTGGACCAAGTACATGAACCACCTGACCGTGCACAAC
AGGGAGGTGCTGTACGAGCTCATCGAGAAGCGAGGCCCGGCCACGCCCCTCATCACCGTGTCCAATCAC
CAGTCCTGCATGGACGACCCTCATCTCTGGGGGATCCTGAAACTCCGCCACATCTGGAACCTGAAGTTG
ATGCGTTGGACCCCTGCAGCTGCAGACATCTGCTTCACCAAGGAGCTACACTCCCACTTCTTCAGCTTG
GGCAAGTGTGTGCCTGTGTGCCGAGGAGCAGAATTTTTCCAAGCAGAGAATGAGGGGAAAGGTGTTCTA
GACACAGGCAGGCACATGCCAGGTGCTGGAAAAAGAAGAGAGAAAGGAGATGGCGTCTACCAGAAGGGG
ATGGACTTCATTTTGGAGAAGCTCAACCATGGGGACTGGGTGCATATCTTCCCAGAAGGAATCGGGCGC
CTGATTGCTGAGTGTCATCTCAACCCCATCATCCTGCCCCTGTGGCATGTCGGAATGAATGACGTCCTT
CCTAACAGTCCGCCCTACTTCCCCCGCTTTGGACAGAAAATCACTGTGCTGATCGGGAAGCCCTTCAGT
GCCCTGCCTGTACTCGAGCGGCTCCGGGCGGAGAACAAGTCGGCTGTGGAGATGCGGAAAGCCCTGACG
GACTTCATTCAAGAGGAATTCCAGCATCTGAAGACTCAGGCAGAGCAGCTCCACAACCACCTCCAGCCT
GGGAGATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_181312
Insert Size 837 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_181312.3
RefSeq Size 1899 bp
RefSeq ORF 837 bp
Locus ID 6901
UniProt ID Q16635
Protein Families ES Cell Differentiation/IPS, Transmembrane
MW 31.7 kDa
Gene Summary This gene encodes a protein that is expressed at high levels in cardiac and skeletal muscle. Mutations in this gene have been associated with a number of clinical disorders including Barth syndrome, dilated cardiomyopathy (DCM), hypertrophic DCM, endocardial fibroelastosis, and left ventricular noncompaction (LVNC). Multiple transcript variants encoding different isoforms have been described. A long form and a short form of each of these isoforms is produced; the short form lacks a hydrophobic leader sequence and may exist as a cytoplasmic protein rather than being membrane-bound. Other alternatively spliced transcripts have been described but the full-length nature of all these transcripts is not known. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) lacks an in-frame coding exon compared to variant 1, resulting in a shorter isoform (3) compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...