FBXO22 (NM_012170) Human Untagged Clone

CAT#: SC312773

FBXO22 (untagged)-Human F-box protein 22 (FBXO22), transcript variant 2



  "NM_012170" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
FBXO22 mouse monoclonal antibody,clone OTI1H1
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FBX22; FISTC1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC312773 representing NM_012170.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGCCGGTAGGCTGCTGCGGCGAGTGCCGCGGCTCCTCCGTAGACCCGCGGAGCACCTTCGTGTTG
AGTAACCTGGCGGAGGTGGTGGAGCGTGTGCTCACCTTCCTGCCCGCCAAGGCGTTGCTGCGGGTGGCC
TGCGTGTGCCGCTTATGGAGGGAGTGTGTGCGCAGAGTATTGCGGACCCATCGGAGCGTAACCTGGATC
TCCGCAGGCCTGGCGGAGGCCGGCCACCTGGAGGGGCATTGCTTGGTTCGCGTGGTAGCAGAGGAGCTT
GAGAATGTTCGCATCTTACCACATACAGTTCTTTACATGGCTGATTCAGAAACTTTCATTAGTCTGGAA
GAGTGTCGTGGCCATAAGAGAGCAAGGAAAAGAACTAGTATGGAAACAGCACTTGCCCTTGAGAAGCTA
TTCCCCAAACAATGCCAAGTCCTTGGGATTGTGACCCCAGGAATTGTAGTGACTCCAATGGGATCAGGT
AGCAATCGACCTCAGGAAATAGAAATTGGAGAATCTGGTTTTGCTTTATTATTCCCTCAAATTGAAGGA
ATAAAAATACAACCCTTTCATTTTATTAAGGATCCAAAGAATTTAACATTAGAAAGACATCAACTCACT
GAAGTAGGTCTTTTAGATAACCCTGAACTTCGTGTGGTCCTTGTCTTTGGTTATAATTGCTGTAAGGTG
GGAGCCAGTAATTATCTGCAGCAAGTAGTCAGCACTTTCAGTGATATGAATATCATCTTGGCTGGAGGC
CAGGTGGACAACCTGTCATCACTGACTTCTGAAAAGTATGTCTTGTGTGCTTCTGATTTCGTCTGTGAA
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_012170
Insert Size 831 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_012170.3
RefSeq Size 1717 bp
RefSeq ORF 831 bp
Locus ID 26263
UniProt ID Q8NEZ5
Domains F-box
Protein Families Druggable Genome
MW 30.6 kDa
Gene Summary This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and, as a transcriptional target of the tumor protein p53, is thought to be involved in degradation of specific proteins in response to p53 induction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (2) contains a distinct 3' coding sequence and 3' UTR compared to variant 1. This results in a shorter isoform (b) with a distinct C-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...