PSMF1 (NM_178578) Human Untagged Clone

CAT#: SC312741

PSMF1 (untagged)-Human proteasome (prosome, macropain) inhibitor subunit 1 (PI31) (PSMF1), transcript variant 2



  "NM_178578" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
PSMF1 mouse monoclonal antibody, clone OTI2D7 (formerly 2D7)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PI31
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC312741 representing NM_178578.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGGCCTGGAGGTACTGTTCGCATCGGCAGCGCCGGCCATCACCTGCAGGCAGGACGCGCTCGTC
TGCTTCTTGCATTGGGAAGTGGTGACACACGGTTACTTCGGCTTGGGTGTCGGTGACCAGCCGGGTCCC
AATGATAAGAAGTCAGAACTGCTGCCAGCTGGGTGGAACAACAATAAAGACCTGTATGTCCTCCGGTAT
GAGTATAAGGATGGGTCCAGAAAGCTCCTTGTGAAAGCCATCACCGTGGAGAGCAGCATGATCCTCAAT
GTGCTGGAATATGGCTCACAGCAAGTGGCAGACTTGACCCTGAACTTGGATGATTATATCGATGCAGAA
CACCTGGGTGACTTCCACAGGACCTACAAGAACAGTGAGGAGCTTCGGTCTCGTATTGTGTCTGGAATC
ATCACACCTATCCATGAGCAGTGGGAAAAGGCTAATGTAAGCAGTCCCCACCGGGAGTTCCCCCCTGCT
ACCGCCAGAGAGGTGGACCCACTCCGGATTCCTCCACACCACCCACACACCAGTCGGCAGCCTCCCTGG
TGTGATCCCCTGGGCCCGTTTGTTGTCGGGGGAGAAGACTTAGACCCTTTTGGGCCTCGGAGAGGTGGC
ATGATTGTGGATCCCCTGAGATCTGGCTTCCCAAGAGCACTTATTGACCCTTCCTCAGGCCTCCCGAAC
CGACTTCCTCCAGGCGCTGTGCCCCCAGGAGCTCGCTTTGACCCCTTTGGACCCATTGGGACCAGCCCA
CCCGGACCTAACCCAGACCATCTCCCCCCGCCGGGCTACGATGACATGTACCTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_178578
Insert Size 816 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_178578.3
RefSeq Size 8195 bp
RefSeq ORF 816 bp
Locus ID 9491
UniProt ID Q92530
Protein Pathways Proteasome
MW 29.8 kDa
Gene Summary The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a protein that inhibits the activation of the proteasome by the 11S and 19S regulators. Alternative transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...