APOLD1 (NM_030817) Human Untagged Clone
CAT#: SC312634
APOLD1 (untagged)-Human apolipoprotein L domain containing 1 (APOLD1), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | VERGE |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC312634 representing NM_030817.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGAATGGAGAGGCCGGCGGCCCGGGAGCCGCATGGGCCCGACGCGCTGCGGCGCTTCCAGGGACTG CTGCTGGACCGCCGAGGCCGGCTGCACGGCCAGGTGCTGCGCCTGCGCGAGGTGGCCCGGCGCCTGGAG CGCCTGCGCAGGCGCTCCCTCGTAGCCAACGTGGCCGGCAGCTCGCTGAGCGCAACGGGCGCCCTCGCC GCCATCGTGGGGCTCTCGCTCAGCCCGGTCACCCTGGGGACCTCGCTGCTGGTGTCGGCCGTGGGGCTG GGGGTGGCCACAGCCGGAGGGGCCGTCACCATCACGTCCGATCTCTCGCTGATCTTCTGCAACTCCCGG GAGCTGCGGAGGGTGCAGGAGATCGCGGCCACCTGCCAGGACCAGATGCGAGAGATCCTGAGCTGCCTC GAGTTTTTCTGCCGCTGGCAGGGCTGCGGGGACCGCCAGCTGCTGCAGTGCGGGAGGAACGCCTCCATC GCCCTGTACAATTCTGTCTACTTCATCGTCTTCTTTGGCTCACGTGGCTTCCTCATCCCCAGGCGGGCG GAGGGGGACACCAAGGTTAGCCAGGCCGTGCTGAAGGCCAAGATTCAGAAACTGGCCGAGAGCCTGGAG TCCTGCACCGGGGCTCTGGACGAACTCAGCGAGCAGCTGGAGTCTCGGGTTCAGCTCTGCACCAAGTCC AGTCGTGGCCACGACCTCAAGATCTCTGCTGACCAGCGTGCAGGGCTGTTTTTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_030817 |
Insert Size | 747 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_030817.2 |
RefSeq Size | 4660 bp |
RefSeq ORF | 747 bp |
Locus ID | 81575 |
UniProt ID | Q96LR9 |
Protein Families | Transmembrane |
MW | 27.1 kDa |
Gene Summary | APOLD1 is an endothelial cell early response protein that may play a role in regulation of endothelial cell signaling and vascular function (Regard et al., 2004 [PubMed 15102925]).[supplied by OMIM, Dec 2008] Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region, compared to variant 1. The resulting isoform (2) contains a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223903 | APOLD1 (Myc-DDK-tagged)-Human apolipoprotein L domain containing 1 (APOLD1), transcript variant 2 |
CNY 2,400.00 |
|
RC223903L1 | Lenti ORF clone of Human apolipoprotein L domain containing 1 (APOLD1), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC223903L2 | Lenti ORF clone of Human apolipoprotein L domain containing 1 (APOLD1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC223903L3 | Lenti ORF clone of Human apolipoprotein L domain containing 1 (APOLD1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC223903L4 | Lenti ORF clone of Human apolipoprotein L domain containing 1 (APOLD1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG223903 | APOLD1 (tGFP-tagged) - Human apolipoprotein L domain containing 1 (APOLD1), transcript variant 2 |
CNY 4,370.00 |