Synaptogyrin 1 (SYNGR1) (NM_004711) Human Untagged Clone
CAT#: SC312566
SYNGR1 (untagged)-Human synaptogyrin 1 (SYNGR1), transcript variant 1a
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_004711, the custom clone sequence may differ by one or more nucleotides
ATGGAAGGGGGTGCGTACGGAGCGGGCAAAGCCGGGGGCGCCTTCGACCCCTACACCCTG GTCCGGCAGCCGCACACCATCCTGCGCGTCGTGTCTTGGCTGTTCTCCATAGTGGTGTTC GGCTCCATCGTGAACGAGGGCTACCTCAACAGCGCCTCCGAGGGGGAGGAGTTCTGCATC TACAACCGCAACCCCAACGCCTGCAGCTATGGCGTGGCCGTGGGCGTGCTCGCCTTCCTC ACCTGCCTGCTGTACCTGGCCCTGGACGTGTACTTCCCGCAGATCAGCAGCGTCAAGGAC CGCAAGAAAGCCGTCCTGTCCGACATCGGTGTCTCGGCCTTCTGGGCTTTCCTCTGGTTC GTGGGATTCTGCTACCTGGCCAACCAGTGGCAGGTCTCCAAGCCCAAGGACAACCCACTG AACGAAGGGACGGACGCAGCCCGGGCCGCCATCGCCTTCTCCTTTTTCTCCATCTTCACC TGGGCGGGCCAGGCTGTGCTGGCCTTCCAGCGGTACCAGATTGGCGCCGACTCGGCCCTC TTCTCCCAGGACTACATGGACCCCAGCCAGGACTCCAGCATGCCTTACGCGCCCTACGTG GAGCCCACTGGGCCGGATCCCGCCGGTATGGGCGGCACCTACCAGCAGCCGGCCAACACC TTCGACACCGAGCCCCAGGGCTACCAGTCGCAGGGCTAC |
Restriction Sites | Please inquire |
ACCN | NM_004711 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_004711.3, NP_004702.2 |
RefSeq Size | 4425 bp |
RefSeq ORF | 702 bp |
Locus ID | 9145 |
UniProt ID | O43759 |
Domains | Synaptogyrin |
Protein Families | Transmembrane |
Gene Summary | This gene encodes an integral membrane protein associated with presynaptic vesicles in neuronal cells. The exact function of this protein is unclear, but studies of a similar murine protein suggest that it functions in synaptic plasticity without being required for synaptic transmission. The gene product belongs to the synaptogyrin gene family. Three alternatively spliced variants encoding three different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1a) represents the longest transcript and encodes the longest predominantly expressed isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213780 | SYNGR1 (Myc-DDK-tagged)-Human synaptogyrin 1 (SYNGR1), transcript variant 1a |
CNY 3,990.00 |
|
RC213780L3 | Lenti-ORF clone of SYNGR1 (Myc-DDK-tagged)-Human synaptogyrin 1 (SYNGR1), transcript variant 1a |
CNY 5,890.00 |
|
RC213780L4 | Lenti-ORF clone of SYNGR1 (mGFP-tagged)-Human synaptogyrin 1 (SYNGR1), transcript variant 1a |
CNY 5,890.00 |
|
RG213780 | SYNGR1 (tGFP-tagged) - Human synaptogyrin 1 (SYNGR1), transcript variant 1a |
CNY 5,440.00 |