CACNG6 (NM_145815) Human Untagged Clone

CAT#: SC312487

CACNG6 (untagged)-Human calcium channel, voltage-dependent, gamma subunit 6 (CACNG6), transcript variant 2



  "NM_145815" in other vectors (6)

CN¥ 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal CACNG6 Antibody (Center)
    • 400 ul

CN¥ 6,160.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC312487 representing NM_145815.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATGTGGTCCAACTTCTTCCTGCAAGAGGAGAACCGGCGGCGGGGGGCCGCGGGCCGGCGGCGGGCG
CACGGGCAGGGCAGGTCGGGGCTGACGCCCGAGCGCGAGGGGAAGGTGAAGCTGGCGCTGCTGCTGGCC
GCCGTGGGCGCCACGCTGGCGGTGCTGTCCGTGGGCACCGAGTTCTGGGTGGAGCTCAACACCTACAAG
GCCAACGGCAGCGCCGTGTGCGAAGCGGCCCACCTGGGGCTGTGGAAGGCGTGCACCAAGCGGCTGTGG
CAGGCGGACGTGCCCGTGGACAGGGACACCTGCGGCCCCGCGGAGCTGCCCGGAGAAGCAAACTGCACC
TATTTTAAATTCTTCACCACGGGGGAGAATGCACGCATCTTTCAGAGAACCACAAAGAAAGGCCTGCTG
CTCTTGGTGAGCCTGGAGGTGTTCCGGCATTCCGTGAGGGCCCTGCTGCAGAGAGTCAGCCCGGAGCCT
CCCCCGGCCCCACGCCTCACCTACGAGTACTCCTGGTCCCTGGGCTGCGGCGTGGGGGCCGGCCTGATC
CTGCTGTTGGGGGCCGGCTGCTTTCTGCTGCTCACACTGCCTTCCTGGCCCTGGGGGTCCCTCTGTCCC
AAGCGGGGGCACCGGGCCACCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_145815
Insert Size 645 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_145815.1
RefSeq Size 1748 bp
RefSeq ORF 645 bp
Locus ID 59285
UniProt ID Q9BXT2
Protein Families Druggable Genome, Ion Channels: Other, Transmembrane
Protein Pathways Arrhythmogenic right ventricular cardiomyopathy (ARVC), Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), MAPK signaling pathway
MW 23.5 kDa
Gene Summary Voltage-dependent calcium channels are composed of five subunits. The protein encoded by this gene represents one of these subunits, gamma, and is one of two known gamma subunit proteins. This particular gamma subunit is an integral membrane protein that is thought to stabilize the calcium channel in an inactive (closed) state. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members that function as transmembrane AMPA receptor regulatory proteins (TARPs). Alternative splicing results in multiple transcript variants. Variants in this gene have been associated with aspirin-intolerant asthma. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in a shorter isoform (b) with the same N- and C-termini as isoform a. This variant lacks publicly available transcript support but it is supported by RT-PCR data in PubMed ID:11170751. CCDS Note: This CCDS representation lacks publicly available transcript support. The represented exon combination is supported by RT-PCR data in PMID:11170751 and by RNA-Seq data from the ENCODE project.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...