PGPEP1 (NM_017712) Human Untagged Clone
CAT#: SC312465
PGPEP1 (untagged)-Human pyroglutamyl-peptidase I (PGPEP1)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PAP-I; Pcp; PGI; PGP; PGP-I; PGPI |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_017712 edited
ATGGAGCAGCCGAGGAAGGCGGTGGTAGTGACGGGATTTGGCCCTTTTGGGGAACACACC GTGAACGCCAGTTGGATTGCAGTTCAGGAGCTAGAAAAGCTAGGCCTTGGCGACAGCGTG GACCTGCATGTGTACGAGATTCCGGTTGAGTACCAAACAGTCCAGAGACTCATCCCCGCC CTGTGGGAGAAGCACAGTCCACAGCTGGTGGTGCATGTGGGGGTGTCAGGCATGGCGACC ACAGTCACACTGGAGAAATGTGGACACAACAAGGGCTACAAGGGGCTGGACAACTGCCGC TTTTGCCCCGGCTCCCAGTGCTGCGTGGAGGACGGGCCTGAAAGCATTGACTCCATCATC GACATGGATGCTGTGTGCAAGCGAGTCACCACGTTGGGCCTGGATGTGTCGGTGACCATC TCGCAGGATGCCGGCAGATATCTCTGCGACTTTACCTACTACACCTCTTTGTACCAGAGT CACGGTCGATCAGCCTTCGTCCACGTGCCCCCACTGGGGAAGCCGTACAACGCGGACCAG CTGGGCAGGGCACTGAGAGCCATCATTGAGGAGATGTTGGACCTCCTGGAGCAGTCAGAG GGCAAAATCAACTATTGCCACAAACAC |
Restriction Sites | Please inquire |
ACCN | NM_017712 |
Insert Size | 650 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_017712.1, NP_060182.1 |
RefSeq Size | 2239 bp |
RefSeq ORF | 630 bp |
Locus ID | 54858 |
UniProt ID | Q9NXJ5 |
Protein Families | Druggable Genome, Protease |
Gene Summary | The gene encodes a cysteine protease and member of the peptidase C15 family of proteins. The encoded protein cleaves amino terminal pyroglutamate residues from protein substrates including thyrotropin-releasing hormone and other neuropeptides. Expression of this gene may be downregulated in colorectal cancer, while activity of the encoded protein may be negatively correlated with cancer progression in colorectal cancer patients. Activity of the encoded protease may also be altered in other disease states including in liver cirrhosis, which is associated with reduced protease activity, and in necrozoospermia, which is associated with elevated protease activity. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214837 | PGPEP1 (Myc-DDK-tagged)-Human pyroglutamyl-peptidase I (PGPEP1) |
CNY 2,400.00 |
|
RC214837L1 | Lenti ORF clone of Human pyroglutamyl-peptidase I (PGPEP1), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC214837L2 | Lenti ORF clone of Human pyroglutamyl-peptidase I (PGPEP1), mGFP tagged |
CNY 5,890.00 |
|
RC214837L3 | Lenti ORF clone of Human pyroglutamyl-peptidase I (PGPEP1), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC214837L4 | Lenti ORF clone of Human pyroglutamyl-peptidase I (PGPEP1), mGFP tagged |
CNY 4,800.00 |
|
RG214837 | PGPEP1 (tGFP-tagged) - Human pyroglutamyl-peptidase I (PGPEP1) |
CNY 4,000.00 |