CLEC2D (NM_013269) Human Untagged Clone
CAT#: SC312389
CLEC2D (untagged)-Human C-type lectin domain family 2, member D (CLEC2D), transcript variant 1
CNY 2,400.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CLAX; LLT1; OCIL |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_013269 edited
ATGCATGACAGTAACAATGTGGAGAAAGACATTACACCATCTGAATTGCCTGCAAACCCA GGTTGTCTGCATTCAAAAGAGCATTCTATTAAAGCTACCTTAATTTGGCGCTTATTTTTC TTAATCATGTTTCTGACAATCATAGTGTGTGGAATGGTTGCTGCTTTAAGCGCAATAAGA GCTAACTGCCATCAAGAGCCATCAGTATGTCTTCAAGCTGCATGCCCAGAAAGCTGGATT GGTTTTCAAAGAAAGTGTTTCTATTTTTCTGATGACACCAAGAACTGGACATCAAGTCAG AGGTTTTGTGACTCACAAGATGCTGATCTTGCTCAGGTTGAAAGCTTCCAGGAACTGAAT TTCCTGTTGAGATATAAAGGCCCATCTGATCACTGGATTGGGCTGAGCAGAGAACAAGGC CAACCATGGAAATGGATAAATGGTACTGAATGGACAAGACAGTTTCCTATCCTGGGAGCA GGAGAGTGTGCCTATTTGAATGACAAAGGTGCCAGTAGTGCCAGGCACTACACAGAGAGG AAGTGGATTTGTTCCAAATCAGATATACATGTCTAG |
Restriction Sites | Please inquire |
ACCN | NM_013269 |
Insert Size | 2200 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_013269.2, NP_037401.1 |
RefSeq Size | 1739 bp |
RefSeq ORF | 576 bp |
Locus ID | 29121 |
UniProt ID | Q9UHP7 |
Domains | CLECT |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a member of the natural killer cell receptor C-type lectin family. The encoded protein inhibits osteoclast formation and contains a transmembrane domain near the N-terminus as well as the C-type lectin-like extracellular domain. Several alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Oct 2010] Transcript Variant: This variant (1) represents the most frequently occurring transcript. It encodes isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213794 | CLEC2D (Myc-DDK-tagged)-Human C-type lectin domain family 2, member D (CLEC2D), transcript variant 1 |
CNY 2,400.00 |
|
RC213794L1 | Lenti ORF clone of Human C-type lectin domain family 2, member D (CLEC2D), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC213794L2 | Lenti ORF clone of Human C-type lectin domain family 2, member D (CLEC2D), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC213794L3 | Lenti ORF clone of Human C-type lectin domain family 2, member D (CLEC2D), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC213794L4 | Lenti ORF clone of Human C-type lectin domain family 2, member D (CLEC2D), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG213794 | CLEC2D (tGFP-tagged) - Human C-type lectin domain family 2, member D (CLEC2D), transcript variant 1 |
CNY 4,370.00 |