SIAH3 (AK096522) Human Untagged Clone

CAT#: SC312357

(untagged)-Human cDNA FLJ39203 fis, clone OCBBF2005420, moderately similar to DEVELOPMENTAL PROTEIN SEVEN IN ABSENTIA



CNY 9,120.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-SIAH3 Antibody
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK096522, the custom clone sequence may differ by one or more nucleotides
ATGTGTCCCTTGTTCTCCTGCCAGTGGGAAGGCCGCCTGGAGGTGGTGGTGCCCCACCTG
CGGCAGATCCATAGGGTTGACATCCTCCAGGGAGCCGAGATCGTCTTCCTGGCCACGGAC
ATGCACCTCCCCGCGCCGGCTGATTGGATCATCATGCACTCCTGCCTTGGCCACCACTTT
CTGTTGGTGCTGAGGAAACAGGAGAGGCATGAAGGGCACCCCCAGTTCTTTGCCACCATG
ATGCTGATTGGGACCCCCACCCAGGCCGACTGCTTCACCTATCGCCTGGAGGATATAGTT
CTGGTCCAGCTGGGAGACACGAGGGTCACAGGCATGGAGAATGGAGATGGAGGGGGAGCC
CGGTCCGTGGGCCCCAAGAGCCGAGCCGGGCGAGGGATGGAGTGGGGAGACGCAGGAGGG
CGGTGTCTAGGGCTGGGGAATGGGGTCGTGTCTGGCACCCCGGTGGGGACTGTATTGGAA
GGCAGCCCAGAATGGGCAGCGGCGAGGAGTGAACACCTGGCTGCAGGTGACGGCCAAGGA
AGGAGGATTGCT
Restriction Sites Please inquire     
ACCN AK096522
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq AK096522.1, BAC04809.1
RefSeq Size 2142 bp
RefSeq ORF 2142 bp
Locus ID 283514
Domains Sina
Gene Summary Negative regulator of PRKN translocation to damaged mitochondria. Acts probably by destabilizing PINK1 protein, hence inhibiting PRKN targeting to dysfunctional depolarized mitochondria.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...