Dystonin (DST) (AK025142) Human Untagged Clone
CNY 9,120.00
货期*
4周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BP240; BPA; BPAG1; CATX-15; CATX15; D6S1101; DMH; DT; EBSB2; HSAN6; MACF2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for AK025142, the custom clone sequence may differ by one or more nucleotides
ATGGAGTGGCTAGAAGAGTCAGAAAAGTCTTTGGATTCTGAACTGGAAATCGCAAATGAT CCAGACAAAATAAAAACACAACTTGCACAACATAAGGAGTTTCAGAAATCACTCGGAGCC AAGCATTCTGTCTACGACACCACCAACAGGACTGGACGTTCTCTGAAGGAGAAAACCTCC CTGGCTGATGACAACCTGAAACTGGATGACATGCTGAGTGAACTCAGAGACAAATGGGAT ACCATATGTGGAAAATCTGTGGAAAGACAAAACAAATTGGAGGAAGCCCTGTTATTTTCT GGACAATTCACAGATGCCCTACAGGCTCTCATTGATTGGTTATATAGAGTTGAACCCCAG CTGGCAGAAGACCAGCCTGTTCATGGAGACATTGATTTGGTGATGAATCTGATCGATAAT CACAAGGTATTGTTATCTGGGACATTTTATTTTATCTTGTTTGATTATTCTGAGTGTACA GGAAATGTAAACCATTTAAAT |
Restriction Sites | Please inquire |
ACCN | AK025142 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | AK025142.1, BAB15077.1 |
RefSeq Size | 2250 bp |
RefSeq ORF | 2250 bp |
Locus ID | 667 |
Domains | spectrin |
Gene Summary | This gene encodes a member of the plakin protein family of adhesion junction plaque proteins. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene, but the full-length nature of some variants has not been defined. It has been reported that some isoforms are expressed in neural and muscle tissue, anchoring neural intermediate filaments to the actin cytoskeleton, and some isoforms are expressed in epithelial tissue, anchoring keratin-containing intermediate filaments to hemidesmosomes. Consistent with the expression, mice defective for this gene show skin blistering and neurodegeneration. [provided by RefSeq, Mar 2010] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它Dystonin产品
Customer
Reviews
Loading...