SHMT2 (AK055053) Human Untagged Clone

CAT#: SC312033

(untagged)-Human cDNA FLJ30491 fis, clone BRAWH2000177, moderately similar to SERINE HYDROXYMETHYLTRANSFERASE, MITOCHONDRIAL PRECURSOR (EC 2.1.2.1)



CNY 9,120.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
SHMT2 mouse monoclonal antibody, clone OTI3E9 (formerly 3E9)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GLYA; HEL-S-51e; SHMT
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK055053, the custom clone sequence may differ by one or more nucleotides
ATGCTGTACTTCTCTTTGTTTTGGGCGGCTCGGCCTCTGCAGAGATGTGGGCAGCTGGTC
AGGATGGCCATTCGGGCTCAGCACAGCAACGCAGCCCAGACTCAGACTGGGGAAGCAAAC
AGGGGCTGGACAGGCCAGGAGAGCCTGTCGGACAGTGATCCTGAGATGTGGGAGTTGCTG
CAGAGGGAGAAGGACAGGCAGTGTCGTGGCCTGGAGCTCATTGCCTCAGAGGTGGGACCT
GGGGAGATGGGCAGGGGTTGGGCCACCATGGGTACAGGAAGTAACAAAGTTATCTTAACT
GATATTTCTCCAAAACCCCCTTTCACACTCAGGACCTTTCTTTGGGCTTTATCTTCCTTT
CTTATCTCCCTCAAGCAAAGGCAGTGCAAGTCCAGTTTATGGGGT
Restriction Sites Please inquire     
ACCN AK055053
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq AK055053.1
RefSeq Size 3412 bp
RefSeq ORF 3412 bp
Locus ID 6472
Protein Pathways Cyanoamino acid metabolism, Glycine, serine and threonine metabolism, Metabolic pathways, Methane metabolism, One carbon pool by folate
Gene Summary This gene encodes the mitochondrial form of a pyridoxal phosphate-dependent enzyme that catalyzes the reversible reaction of serine and tetrahydrofolate to glycine and 5,10-methylene tetrahydrofolate. The encoded product is primarily responsible for glycine synthesis. The activity of the encoded protein has been suggested to be the primary source of intracellular glycine. The gene which encodes the cytosolic form of this enzyme is located on chromosome 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...