Inversin (INVS) (BC006370) Human Untagged Clone
CAT#: SC311624
INVS (untagged)-Homo sapiens, Similar to inversin, clone MGC:12888 IMAGE:4138301, complete cds
CNY 9,120.00
货期*
4周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | INV; NPH2; NPHP2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for BC006370, the custom clone sequence may differ by one or more nucleotides
ATGAACAAGTCAGAGAACCTGCTGTTTGCTGGTTCATCATTAGCATCACAAGTCCATGCT GCTGCCGTTAATGGAGATAAGGGTGCTCTACAGAGGCTCATCGTAGGAAACTCTGCTCTT AAAGACAAAGAAGATCAGTTTGGGAGAACACCACTTATGTATTGCGTGTTGGCTGACAGA TTGGATTGTGCAGATGCTCTTCTGAAGGCAGGAGCAGATGTGAATAAAACTGACCATAGC CAGAGAACAGCCCTCCATCTTGCAGCCCAGAAGGCATTGAGAACAATCAGCACAGGCAGG ATC |
Restriction Sites | Please inquire |
ACCN | BC006370 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC006370.1, AAH06370.1 |
RefSeq Size | 1683 bp |
RefSeq ORF | 1683 bp |
Locus ID | 27130 |
Domains | ANK |
Gene Summary | This gene encodes a protein containing multiple ankyrin domains and two IQ calmodulin-binding domains. The encoded protein may function in renal tubular development and function, and in left-right axis determination. This protein interacts with nephrocystin and infers a connection between primary cilia function and left-right axis determination. A similar protein in mice interacts with calmodulin. Mutations in this gene have been associated with nephronophthisis type 2. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2012] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...