TNNT3 (NM_001042782) Human Untagged Clone
CAT#: SC311461
TNNT3 (untagged)-Human troponin T type 3 (skeletal, fast) (TNNT3), transcript variant 4
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | beta-TnTF; DA2B2; TNTF |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC311461 representing NM_001042782.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCTGACGAGGAAGTTGAACAGGTGGAGGAGCAGTACGAAGAAGAAGAGGAAGCCCAGGAGGAAGAG GAAGTTCAAGAAGAGGAGAAACCGAGACCCAAACTCACTGCTCCTAAGATCCCAGAAGGGGAGAAAGTG GACTTCGATGACATCCAGAAGAAGCGTCAGAACAAAGACCTAATGGAGCTCCAGGCCCTCATCGACAGC CACTTTGAAGCCCGGAAGAAGGAGGAGGAGGAGCTGGTCGCTCTCAAAGAGAGAATCGAGAAGCGCCGT GCAGAGAGAGCGGAGCAGCAGAGGATTCGTGCAGAGAAGGAGAGGGAGCGCCAGAACAGACTGGCGGAG GAAAAGGCCAGAAGGGAGGAGGAGGATGCCAAGAGGAGGGCAGAGGACGACCTGAAGAAGAAGAAAGCT CTGTCTTCCATGGGAGCCAACTACAGCAGCTACCTGGCCAAGGCTGACCAGAAGAGAGGCAAGAAGCAG ACAGCCCGGGAAATGAAGAAGAAGATTCTGGCTGAGAGACGCAAGCCGCTCAACATCGATCACCTTGGT GAAGACAAACTGAGGGACAAGGCCAAGGAGCTCTGGGAGACCCTGCACCAGCTGGAGATTGACAAGTTC GAGTTTGGGGAGAAGCTGAAACGCCAGAAATATGACATCACCACGCTCAGGAGCCGCATTGACCAGGCC CAGAAGCACAGCAAGAAGGCTGGGACCCCAGCCAAGGGCAAAGTCGGCGGGCGCTGGAAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001042782 |
Insert Size | 753 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001042782.2 |
RefSeq Size | 1193 bp |
RefSeq ORF | 753 bp |
Locus ID | 7140 |
UniProt ID | P45378 |
MW | 29.7 kDa |
Gene Summary | The binding of Ca(2+) to the trimeric troponin complex initiates the process of muscle contraction. Increased Ca(2+) concentrations produce a conformational change in the troponin complex that is transmitted to tropomyosin dimers situated along actin filaments. The altered conformation permits increased interaction between a myosin head and an actin filament which, ultimately, produces a muscle contraction. The troponin complex has protein subunits C, I, and T. Subunit C binds Ca(2+) and subunit I binds to actin and inhibits actin-myosin interaction. Subunit T binds the troponin complex to the tropomyosin complex and is also required for Ca(2+)-mediated activation of actomyosin ATPase activity. There are 3 different troponin T genes that encode tissue-specific isoforms of subunit T for fast skeletal-, slow skeletal-, and cardiac-muscle. This gene encodes fast skeletal troponin T protein; also known as troponin T type 3. Alternative splicing results in multiple transcript variants encoding additional distinct troponin T type 3 isoforms. A developmentally regulated switch between fetal/neonatal and adult troponin T type 3 isoforms occurs. Additional splice variants have been described but their biological validity has not been established. Mutations in this gene may cause distal arthrogryposis multiplex congenita type 2B (DA2B). [provided by RefSeq, Oct 2009] Transcript Variant: This variant (4) lacks an internal coding exon compared to transcript variant 1, resulting in a shorter isoform (4) missing an 8 aa segment compared to isoform 1. Variants 4, 5, and 9 all encode the same isoform (4). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223893 | TNNT3 (Myc-DDK-tagged)-Human troponin T type 3 (skeletal, fast) (TNNT3), transcript variant 4 |
CNY 2,400.00 |
|
RC223893L3 | Lenti ORF clone of Human troponin T type 3 (skeletal, fast) (TNNT3), transcript variant 4, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC223893L4 | Lenti ORF clone of Human troponin T type 3 (skeletal, fast) (TNNT3), transcript variant 4, mGFP tagged |
CNY 5,890.00 |
|
RG223893 | TNNT3 (tGFP-tagged) - Human troponin T type 3 (skeletal, fast) (TNNT3), transcript variant 4 |
CNY 4,000.00 |