RHOC (NM_001042678) Human Untagged Clone
CAT#: SC311454
RHOC (untagged)-Human ras homolog gene family, member C (RHOC), transcript variant 2
CNY 3,990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARH9; ARHC; H9; RHOH9 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC311454 representing NM_001042678.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTGCAATCCGAAAGAAGCTGGTGATCGTTGGGGATGGTGCCTGTGGGAAGACCTGCCTCCTCATC GTCTTCAGCAAGGATCAGTTTCCGGAGGTCTACGTCCCTACTGTCTTTGAGAACTATATTGCGGACATT GAGGTGGACGGCAAGCAGGTGGAGCTGGCTCTGTGGGACACAGCAGGGCAGGAAGACTATGATCGACTG CGGCCTCTCTCCTACCCGGACACTGATGTCATCCTCATGTGCTTCTCCATCGACAGCCCTGACAGCCTG GAAAACATTCCTGAGAAGTGGACCCCAGAGGTGAAGCACTTCTGCCCCAACGTGCCCATCATCCTGGTG GGGAATAAGAAGGACCTGAGGCAAGACGAGCACACCAGGAGAGAGCTGGCCAAGATGAAGCAGGAGCCC GTTCGGTCTGAGGAAGGCCGGGACATGGCGAACCGGATCAGTGCCTTTGGCTACCTTGAGTGCTCAGCC AAGACCAAGGAGGGAGTGCGGGAGGTGTTTGAGATGGCCACTCGGGCTGGCCTCCAGGTCCGCAAGAAC AAGCGTCGGAGGGGCTGTCCCATTCTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001042678 |
Insert Size | 582 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001042678.1 |
RefSeq Size | 1346 bp |
RefSeq ORF | 582 bp |
Locus ID | 389 |
UniProt ID | P08134 |
Protein Families | Druggable Genome |
MW | 22 kDa |
Gene Summary | This gene encodes a member of the Rho family of small GTPases, which cycle between inactive GDP-bound and active GTP-bound states and function as molecular switches in signal transduction cascades. Rho proteins promote reorganization of the actin cytoskeleton and regulate cell shape, attachment, and motility. The protein encoded by this gene is prenylated at its C-terminus, and localizes to the cytoplasm and plasma membrane. It is thought to be important in cell locomotion. Overexpression of this gene is associated with tumor cell proliferation and metastasis. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an alternate exon in the 5' UTR compared to variant 1. Variants 1, 2, and 3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208751 | RHOC (Myc-DDK-tagged)-Human ras homolog gene family, member C (RHOC), transcript variant 2 |
CNY 2,400.00 |
|
RC208751L1 | Lenti ORF clone of Human ras homolog gene family, member C (RHOC), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC208751L2 | Lenti ORF clone of Human ras homolog gene family, member C (RHOC), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC208751L3 | Lenti ORF clone of Human ras homolog gene family, member C (RHOC), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC208751L4 | Lenti ORF clone of Human ras homolog gene family, member C (RHOC), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG208751 | RHOC (tGFP-tagged) - Human ras homolog gene family, member C (RHOC), transcript variant 2 |
CNY 4,370.00 |