PIGY (NM_001042616) Human Untagged Clone
CAT#: SC311437
PIGY (untagged)-Human phosphatidylinositol glycan anchor biosynthesis, class Y (PIGY), nuclear gene encoding mitochondrial protein, transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HPMRS6; PIG-Y |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001042616, the custom clone sequence may differ by one or more nucleotides
ATGTTTCTGTCTCTTCCTACGTTGACTGTTCTTATTCCACTGGTTTCTTTAGCAGGACTG TTCTACTCAGCCTCTGTGGAAGAAAACTTCCCACAGGGCTGCACTAGCACAGCCAGCCTT TGCTTTTACAGCCTGCTCTTGCCTATTACCATACCAGTGTATGTATTCTTCCACCTTTGG ACTTGGATGGGTATTAAACTCTTCAGGCATAATTGA |
Restriction Sites | Please inquire |
ACCN | NM_001042616 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001042616.1, NP_001036081.1 |
RefSeq Size | 1353 bp |
RefSeq ORF | 216 bp |
Locus ID | 84992 |
UniProt ID | Q3MUY2 |
Protein Pathways | Glycosylphosphatidylinositol(GPI)-anchor biosynthesis, Metabolic pathways |
Gene Summary | The protein encoded by this gene is part of the GPI-N-acetylglucosaminyltransferase (GIP-GnT) complex which initiates the biosynthesis of glycosylphosphatidylinositol (GPI). GPI is synthesized in the endoplasmic reticulum and serves as an anchor for many surface proteins. Proteins containing GPI anchors can have an important role in cell-cell interactions. The transcript for this gene is bicistronic. The downstream open reading frame encodes this GPI-GnT complex protein, while the upstream open reading frame encodes a protein with unknown function, as represented by GeneID:100996939. [provided by RefSeq, Aug 2012] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217655 | PIGY (Myc-DDK-tagged)-Human phosphatidylinositol glycan anchor biosynthesis, class Y (PIGY), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 1,200.00 |
|
RC217655L3 | Lenti-ORF clone of PIGY (Myc-DDK-tagged)-Human phosphatidylinositol glycan anchor biosynthesis, class Y (PIGY), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,890.00 |
|
RC217655L4 | Lenti-ORF clone of PIGY (mGFP-tagged)-Human phosphatidylinositol glycan anchor biosynthesis, class Y (PIGY), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,890.00 |
|
RG217655 | PIGY (tGFP-tagged) - Human phosphatidylinositol glycan anchor biosynthesis, class Y (PIGY), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4,370.00 |