TPK1 (NM_001042482) Human Untagged Clone
CAT#: SC311347
TPK1 (untagged)-Human thiamin pyrophosphokinase 1 (TPK1), transcript variant 2
CNY 3,990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HTPK1; PP20; THMD5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC311347 representing NM_001042482.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGCATGCCTTTACCCCGTTGGAGCCCCTGCTTTCCACTGGGAATTTGAAGTACTGCCTTGTAATT CTTAATCAGCCTTTGGACAACTATTTTCGTCATCTTTGGAACAAAGCTCTTTTAAGAGCCTGTGCCGAT GGAGGTGCCAACCGCTTATATGATATCACCGAAGGAGAGAGAGAAAGCTTTTTGCCTGAATTCATCAAT GGAGACTTTGATTCTATTAGGCCTGAAGTCAGAGAATACTATGCTACTAAGGGATGTGAGCTCATTTCA ACTCCTGATCAAGACCACACTGACTTTACTAAGTGCCTTAAAATGCTCCAAAAGAAGATAGAAGAAAAA GACTTAAAGGGAAAGCACAGGTTGCATGTAGACACTGGAATGGAGGGTGATTGGTGTGGCCTTATTCCT GTTGGACAGCCTTGTATGCAGGTTACAACCACAGGCCTCAAGTGGAACCTCACAAATGATGTGCTTGCT TTTGGAACATTGGTCAGTACTTCCAATACCTACGACGGGTCTGGTGTTGTGACTGTGGAAACTGACCAC CCACTCCTCTGGACCATGGCCATCAAAAGCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001042482 |
Insert Size | 585 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001042482.1 |
RefSeq Size | 2302 bp |
RefSeq ORF | 585 bp |
Locus ID | 27010 |
UniProt ID | Q9H3S4 |
Protein Families | Druggable Genome |
Protein Pathways | Metabolic pathways, Thiamine metabolism |
MW | 21.9 kDa |
Gene Summary | The protein encoded by this gene functions as a homodimer and catalyzes the conversion of thiamine to thiamine pyrophosphate, a cofactor for some enzymes of the glycolytic and energy production pathways. Defects in this gene are a cause of thiamine metabolism dysfunction syndrome-5. [provided by RefSeq, Apr 2017] Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform b), compared to isoform a. Variants 2 and 4 both encode the same isoform (b). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213647 | TPK1 (Myc-DDK-tagged)-Human thiamin pyrophosphokinase 1 (TPK1), transcript variant 2 |
CNY 2,400.00 |
|
RC213647L3 | Lenti ORF clone of Human thiamin pyrophosphokinase 1 (TPK1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC213647L4 | Lenti ORF clone of Human thiamin pyrophosphokinase 1 (TPK1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG213647 | TPK1 (tGFP-tagged) - Human thiamin pyrophosphokinase 1 (TPK1), transcript variant 2 |
CNY 4,370.00 |