United States
Germany
Japan
United Kingdom
China
PTPN20A (NM_001042393) Human Untagged Clone
CAT＃: SC311235
PTPN20A (untagged)-Human protein tyrosine phosphatase, non-receptor type 20A (PTPN20A), transcript variant 6
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | bA142I17.1; CT126; hPTPN20; PTPN20B |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001042393, the custom clone sequence may differ by one or more nucleotides
ATGATTGTAAACGATTATGAGGGAAATGACTCTGAAGCAGAAGACTTGAATTTCAGGGAG ACTTTGCCTTCATCAAGTCAGGAAAACACACCTAGATCAAAGGTTTTTGAAAATAAAGTT AATTCAGAGAAGGTAAAACTTTCTCTTCGGAATTTCCCACATAATGATTATGAGGATGTT TTTGAAGAGCCTTCAGAAAGTGGCAGTGATCCCAGCATGTGGACAGCCAGAGGCCCCTTC AGAAGAGACAGGTGGAGCAGTGAGGATGAGGAGGCTGCAGGGCCATCACAGGCTCTCTCC CCTCTACTTTCTGATACGCGCAAAATTGTTTCTGAAGGAGAACTAGATCAGTTGGCTCAG ATTCGGCCATTAATATTCAATTTTCATGAGCAGACAGCCATCAAGGATTGTTTGAAAATC CTTGAGGAAAAAACAGCAGCGTATGATATCATGCAGGAATTTATGGCTTTAGAACTTAAG AATCTGCCTGGTGAGTTCAACTCTGGGAATCAACCAAGCAACAGAGAAAAAAACAGATAC CGAGATATTCTTCCATTTCAACATCATGGATATAGTGGCCCAAATGAGAGAACAACGTTC TGGCATGGTTCAAACGAAGGAGCAGTATCACTTTTGTTACGATATTGTGCTTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001042393 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001042393.1, NP_001035852.1 |
| RefSeq Size | 2319 bp |
| RefSeq ORF | 654 bp |
| Locus ID | 653129 |
| Protein Families | Druggable Genome |
| Gene Summary | The product of this gene belongs to the family of classical tyrosine-specific protein tyrosine phosphatases. Many protein tyrosine phosphatases have been shown to regulate fundamental cellular processes and several are mutated in human diseases. Chromosome 10q contains a segmental duplication resulting in multiple copies of the protein tyrosine phosphatase, non-receptor type 20 gene. The two nearly identical copies are designated as PTPN20A and PTPN20B. A third copy is only partially duplicated and contains a pseudogene, designated as PTPN20C. This gene encodes the more centromeric copy, PTPN20A. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (6) has multiple coding region differences, compared to variant 1, one of which results in a frameshift. The resulting protein (isoform 6) contains distinct N- and C-termini, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222945 | PTPN20A (Myc-DDK-tagged)-Human protein tyrosine phosphatase, non-receptor type 20A (PTPN20A), transcript variant 6 |
CNY 3,990.00 |
|
| RC222945L3 | Lenti-ORF clone of PTPN20A (Myc-DDK-tagged)-Human protein tyrosine phosphatase, non-receptor type 20A (PTPN20A), transcript variant 6 |
CNY 5,890.00 |
|
| RC222945L4 | Lenti-ORF clone of PTPN20A (mGFP-tagged)-Human protein tyrosine phosphatase, non-receptor type 20A (PTPN20A), transcript variant 6 |
CNY 5,890.00 |
|
| RG222945 | PTPN20A (tGFP-tagged) - Human protein tyrosine phosphatase, non-receptor type 20A (PTPN20A), transcript variant 6 |
CNY 4,370.00 |
其它PTPN20A产品
