DDX26 (INTS6) (NM_001039938) Human Untagged Clone
CAT#: SC311099
INTS6 (untagged)-Human integrator complex subunit 6 (INTS6), transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DBI-1; DDX26; DDX26A; DICE1; HDB; INT6; Notchl2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC311099 representing NM_001039938.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCCATCTTACTGTTCCTGATAGACACGTCTGCCTCTATGAACCAGCGCAGCCATCTGGGCACCACC TACCTGGACACGGCCAAAGGCGCGGTAGAGACCTTCATGAAGCTCCGTGCCCGGGACCCTGCCAGCAGA GGAGACAGGTATATGCTGGTCACTTTCGAAGAGCCGCCCTATGCTATCAAGGCTGGATGGAAAGAAAAC CATGCAACGTTTATGAATGAATTGAAAAACCTTCAGGCTGAAGGACTTACGACTCTTGGCCAATCCCTA AGGACAGCTTTTGATTTATTAAATTTAAATAGATTAGTAACTGGCATAGACAACTATGGGCAGGTAGGT TGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001039938 |
Insert Size | 348 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001039938.1 |
RefSeq Size | 2494 bp |
RefSeq ORF | 348 bp |
Locus ID | 26512 |
UniProt ID | Q9UL03 |
Protein Families | Druggable Genome |
MW | 12.9 kDa |
Gene Summary | DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. The protein encoded by this gene is a DEAD box protein that is part of a complex that interacts with the C-terminus of RNA polymerase II and is involved in 3' end processing of snRNAs. In addition, this gene is a candidate tumor suppressor and is located in the critical region of loss of heterozygosity (LOH). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2015] Transcript Variant: This variant (3) is missing many 3' exons and contains an alternative segment at the 3' end compared to variant 1. This results in a shorter isoform (c) with a distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215799 | INTS6 (Myc-DDK-tagged)-Human integrator complex subunit 6 (INTS6), transcript variant 3 |
CNY 1,200.00 |
|
RC215799L3 | Lenti ORF clone of Human integrator complex subunit 6 (INTS6), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC215799L4 | Lenti ORF clone of Human integrator complex subunit 6 (INTS6), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG215799 | INTS6 (tGFP-tagged) - Human integrator complex subunit 6 (INTS6), transcript variant 3 |
CNY 4,370.00 |