United States
Germany
Japan
United Kingdom
China
ERK1 (MAPK3) (NM_001040056) Human Untagged Clone
CAT＃: SC311075
MAPK3 (untagged)-Human mitogen-activated protein kinase 3 (MAPK3), transcript variant 2
CNY 5,800.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC311075 representing NM_001040056.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGCGGCGGCGGCTCAGGGGGGCGGGGGCGGGGAGCCCCGTAGAACCGAGGGGGTCGGCCCGGGG GTCCCGGGGGAGGTGGAGATGGTGAAGGGGCAGCCGTTCGACGTGGGCCCGCGCTACACGCAGTTGCAG TACATCGGCGAGGGCGCGTACGGCATGGTCAGCTCGGCCTATGACCACGTGCGCAAGACTCGCGTGGCC ATCAAGAAGATCAGCCCCTTCGAACATCAGACCTACTGCCAGCGCACGCTCCGGGAGATCCAGATCCTG CTGCGCTTCCGCCATGAGAATGTCATCGGCATCCGAGACATTCTGCGGGCGTCCACCCTGGAAGCCATG AGAGATGTCTACATTGTGCAGGACCTGATGGAGACTGACCTGTACAAGTTGCTGAAAAGCCAGCAGCTG AGCAATGACCATATCTGCTACTTCCTCTACCAGATCCTGCGGGGCCTCAAGTACATCCACTCCGCCAAC GTGCTCCACCGAGATCTAAAGCCCTCCAACCTGCTCATCAACACCACCTGCGACCTTAAGATTTGTGAT TTCGGCCTGGCCCGGATTGCCGATCCTGAGCATGACCACACCGGCTTCCTGACGGAGTATGTGGCTACG CGCTGGTACCGGGCCCCAGAGATCATGCTGAACTCCAAGGGCTATACCAAGTCCATCGACATCTGGTCT GTGGGCTGCATTCTGGCTGAGATGCTCTCTAACCGGCCCATCTTCCCTGGCAAGCACTACCTGGATCAG CTCAACCACATTCTGGGCATCCTGGGCTCCCCATCCCAGGAGGACCTGAATTGTATCATCAACATGAAG GCCCGAAACTACCTACAGTCTCTGCCCTCCAAGACCAAGGTGGCTTGGGCCAAGCTTTTCCCCAAGTCA GACTCCAAAGCCCTTGACCTGCTGGACCGGATGTTAACCTTTAACCCCAATAAACGGATCACAGTGGAG GAAGCGCTGGCTCACCCCTACCTGGAGCAGTACTATGACCCGACGGATGAGGTGGGCCAGTCCCCAGCA GCAGTGGGGCTGGGGGCAGGGGAGCAGGGGGGCACGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001040056 |
| Insert Size | 1074 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001040056.2 |
| RefSeq Size | 1174 bp |
| RefSeq ORF | 1074 bp |
| Locus ID | 5595 |
| UniProt ID | P27361 |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Protein Kinase |
| Protein Pathways | Acute myeloid leukemia, Adherens junction, Alzheimer's disease, Axon guidance, B cell receptor signaling pathway, Bladder cancer, Chemokine signaling pathway, Chronic myeloid leukemia, Colorectal cancer, Dorso-ventral axis formation, Endometrial cancer, ErbB signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Gap junction, Glioma, GnRH signaling pathway, Insulin signaling pathway, Long-term depression, Long-term potentiation, MAPK signaling pathway, Melanogenesis, Melanoma, mTOR signaling pathway, Natural killer cell mediated cytotoxicity, Neurotrophin signaling pathway, NOD-like receptor signaling pathway, Non-small cell lung cancer, Oocyte meiosis, Pancreatic cancer, Pathways in cancer, Prion diseases, Progesterone-mediated oocyte maturation, Prostate cancer, Regulation of actin cytoskeleton, Renal cell carcinoma, T cell receptor signaling pathway, TGF-beta signaling pathway, Thyroid cancer, Toll-like receptor signaling pathway, Type II diabetes mellitus, Vascular smooth muscle contraction, VEGF signaling pathway |
| MW | 40.1 kDa |
| Gene Summary | The protein encoded by this gene is a member of the MAP kinase family. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act in a signaling cascade that regulates various cellular processes such as proliferation, differentiation, and cell cycle progression in response to a variety of extracellular signals. This kinase is activated by upstream kinases, resulting in its translocation to the nucleus where it phosphorylates nuclear targets. Alternatively spliced transcript variants encoding different protein isoforms have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2, also known as ERK1c) lacks several exons and its 3'-terminal exon extends past a splice site that is used in variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219888 | MAPK3 (Myc-DDK-tagged)-Human mitogen-activated protein kinase 3 (MAPK3), transcript variant 2 |
CNY 3,656.00 |
|
| RC219888L3 | Lenti ORF clone of Human mitogen-activated protein kinase 3 (MAPK3), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC219888L4 | Lenti ORF clone of Human mitogen-activated protein kinase 3 (MAPK3), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG219888 | MAPK3 (tGFP-tagged) - Human mitogen-activated protein kinase 3 (MAPK3), transcript variant 2 |
CNY 5,256.00 |
