SCN3B (NM_001040151) Human Untagged Clone
CAT#: SC310915
SCN3B (untagged)-Human sodium channel, voltage-gated, type III, beta (SCN3B), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ATFB16; BRGDA7; HSA243396; SCNB3 |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001040151 edited
ATGCCTGCCTTCAATAGATTGTTTCCCCTGGCTTCTCTCGTGCTTATCTACTGGGTCAGT GTCTGCTTCCCTGTGTGTGTGGAAGTGCCCTCGGAGACGGAGGCCGTGCAGGGCAACCCC ATGAAGCTGCGCTGCATCTCCTGCATGAAGAGAGAGGAGGTGGAGGCCACCACGGTGGTG GAATGGTTCTACAGGCCCGAGGGCGGTAAAGATTTCCTTATTTACGAGTATCGGAATGGC CACCAGGAGGTGGAGAGCCCCTTTCAGGGGCGCCTGCAGTGGAATGGCAGCAAGGACCTG CAGGACGTGTCCATCACTGTGCTCAACGTCACTCTGAACGACTCTGGCCTCTACACCTGC AATGTGTCCCGGGAGTTTGAGTTTGAGGCGCATCGGCCCTTTGTGAAGACGACGCGGCTG ATCCCCCTAAGAGTCACCGAGGAGGCTGGAGAGGACTTCACCTCTGTGGTCTCAGAAATC ATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGC TACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCC ATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAG |
Restriction Sites | Please inquire |
ACCN | NM_001040151 |
Insert Size | 1600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001040151.1, NP_001035241.1 |
RefSeq Size | 5682 bp |
RefSeq ORF | 648 bp |
Locus ID | 55800 |
UniProt ID | Q9NY72 |
Protein Families | Druggable Genome, Ion Channels: Sodium, Transmembrane |
Gene Summary | Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel beta subunit gene family, and influences the inactivation kinetics of the sodium channel. Two alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223114 | SCN3B (Myc-DDK-tagged)-Human sodium channel, voltage-gated, type III, beta (SCN3B), transcript variant 2 |
CNY 2,400.00 |
|
RC223114L3 | Lenti ORF clone of Human sodium channel, voltage-gated, type III, beta (SCN3B), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC223114L4 | Lenti ORF clone of Human sodium channel, voltage-gated, type III, beta (SCN3B), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG223114 | SCN3B (tGFP-tagged) - Human sodium channel, voltage-gated, type III, beta (SCN3B), transcript variant 2 |
CNY 4,370.00 |