ethanolamine kinase (ETNK1) (NM_001039481) Human Untagged Clone
CAT#: SC310888
ETNK1 (untagged)-Human ethanolamine kinase 1 (ETNK1), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | EKI; EKI 1; EKI1; Nbla10396 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC310888 representing NM_001039481.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTCTGCGGCCGCCCGCGGTCCAGCTCCGACAACAGGAATTTTCTCCGAGAGCGGGCCGGGCTCAGT TCAGCTGCTGTCCAGACCCGGATCGGCAACAGTGCCGCCTCCAGACGTTCTCCTGCCGCTCGCCCGCCC GTCCCAGCGCCCCCAGCCCTCCCGCGAGGGCGCCCCGGGACGGAAGGATCCACCAGTCTGTCGGCGCCC GCCGTTCTCGTGGTCGCCGTCGCCGTCGTCGTGGTGGTAGTCTCCGCCGTCGCCTGGGCCATGGCCAAT TACATCCACGTCCCTCCCGGCTCCCCGGAGGTGCCCAAGCTGAACGTCACCGTTCAGGATCAGGAGGAG CATCGCTGCCGGGAGGGGGCCCTGAGCCTCCTGCAACACCTGCGGCCTCACTGGGACCCCCAGGAGGTG ACCCTGCAGCTCTTCACAGATGGAATCACAAATAAACTTATTGGCTGTTACGTGGGAAACACCATGGAG GATGTAGTCCTGGTGAGAATTTATGGCAATAAGACTGAGTTATTAGTCGATCGAGATGAGGAAGTAAAG AGTTTTCGAGTGTTGCAGGCTCATGGGTGTGCACCACAACTCTACTGTACCTTCAATAATGGACTATGC TATGAATTTATACAAGGAGAAGCACTGGATCCAAAGCATGTCTGCAACCCAGCCATTTTCAGTTTATCA TCGTTGACTCTTTGCAAAGGAAAAACTACAAGATGTTTTGGATTAACCGGCTGCAGAGGGTCAAGGCTT CTGCTTAGTTTTTTCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001039481 |
Insert Size | 777 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001039481.1 |
RefSeq Size | 910 bp |
RefSeq ORF | 777 bp |
Locus ID | 55500 |
UniProt ID | Q9HBU6 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Glycerophospholipid metabolism, Metabolic pathways |
MW | 28 kDa |
Gene Summary | This gene encodes an ethanolamine kinase, which functions in the first committed step of the phosphatidylethanolamine synthesis pathway. This cytosolic enzyme is specific for ethanolamine and exhibits negligible kinase activity on choline. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) retains the first two exons, uses an alternate third exon, and lacks all other exons, compared to variant 1. The resulting protein (isoform B) is shorter, has a distinct C-terminus, and lacks the putative active site and kinase domain, compared to isoform A. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211556 | ETNK1 (Myc-DDK-tagged)-Human ethanolamine kinase 1 (ETNK1), transcript variant 2 |
CNY 2,400.00 |
|
RC211556L1 | Lenti ORF clone of Human ethanolamine kinase 1 (ETNK1), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC211556L2 | Lenti ORF clone of Human ethanolamine kinase 1 (ETNK1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC211556L3 | Lenti ORF clone of Human ethanolamine kinase 1 (ETNK1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC211556L4 | Lenti ORF clone of Human ethanolamine kinase 1 (ETNK1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG211556 | ETNK1 (tGFP-tagged) - Human ethanolamine kinase 1 (ETNK1), transcript variant 2 |
CNY 4,000.00 |
其它ethanolamine kinase产品