OLAH (NM_001039702) Human Untagged Clone
CAT#: SC310818
OLAH (untagged)-Human oleoyl-ACP hydrolase (OLAH), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AURA1; SAST; TE2; THEDC1 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001039702 edited
ATCCAAAGAAAGTCATCTTTCAGATTGTCTGCTCAGAGTTCATCTCAAAGCCTGGCAAGG ATTGGAGAGGTCAATAAGAGTCAGCGCCTTTAAAAAGAAATCTACTCACTCTTCTGTGTG CATAAGGCCGAGCAGAGGTTCTTCGTCTCAAGAGGAACTGACTTCTGTTGAGCACTCAAC ACGCCACAGAGACCAGCCATCTTGCAACCTCACCTCACAGCATGGAGAGAGGAGACCAAC CTAAGAGAACCAGGAATGAAAACATTTTCAACTGCTTATACAAAAACCCTGAGGCAACTT TTAAGCTGATTTGCTTTCCCTGGATGGGAGGTGGCTCCACTCATTTTGCCAAATGGGGCC AAGATACTCATGATTTGCTGGAAGTGCACTCCTTAAGGCTTCCTGGAAGAGAAAGCAGAG TTGAAGAACCTCTTGAAAATGACATCTCCCAGTTAGTTGATGAAGTTGTTTGTGCTCTGC AGCCAGTCATCCAGGATAAACCATTTGCATTTTTTGGCCACAGTATGGGATCCTACATTG CTTTTAGGACTGCACTAGGTCTAAAAGAAAACAATCAACCAGAACCATTGCATTTATTTT TGTCAAGTGCAACTCCTGTACATTCAAAGGCCTGGCATCGCATTCCCAAAGATGATGAAT TGTCAGAAGAACAAATAAGTCATTACCTTATGGAATTTGGAGGCACCCCCAAGCATTTTG CTGAAGCCAAGGAATTTGTGAAACAATGTAGTCCCATCATAAGGGCAGATCTGAACATTG TTAGAAGTTGCACCTCTAACGTACCATCTAAGGCTGTTCTTTCCTGTGACTTGACATGTT TTGTTGGATCTGAAGACATAGCAAAGGACATGGAAGCCTGGAAAGATGTAACCAGTGGAA ATGCTAAAATTTACCAGCTTCCAGGGGGTCACTTTTATCTTCTGGATCCTGCGAACGAGA AATTAATCAAGAACTACATAATCAAGTGTCTAGAAGTATCATCGATATCCAATTTTTAGA TATTTTCCCTTTCACTTTTAAAATAATCAAAGTAATATCATAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAA |
Restriction Sites | ECoRI-NOT |
ACCN | NM_001039702 |
Insert Size | 1100 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001039702.1, NP_001034791.1 |
RefSeq Size | 1432 bp |
RefSeq ORF | 798 bp |
Locus ID | 55301 |
UniProt ID | Q9NV23 |
Protein Pathways | Fatty acid biosynthesis, Metabolic pathways |
Gene Summary | Contributes to the release of free fatty acids from fatty acid synthase (FASN). Has broad substrate specificity, giving rise to a range of free fatty acids with chain lengths between 10 and 16 carbon atoms (C10 - C16).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208251 | OLAH (Myc-DDK-tagged)-Human oleoyl-ACP hydrolase (OLAH), transcript variant 2 |
CNY 2,400.00 |
|
RC208251L1 | Lenti ORF clone of Human oleoyl-ACP hydrolase (OLAH), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC208251L2 | Lenti ORF clone of Human oleoyl-ACP hydrolase (OLAH), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC208251L3 | Lenti ORF clone of Human oleoyl-ACP hydrolase (OLAH), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC208251L4 | Lenti ORF clone of Human oleoyl-ACP hydrolase (OLAH), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG208251 | OLAH (tGFP-tagged) - Human oleoyl-ACP hydrolase (OLAH), transcript variant 2 |
CNY 4,000.00 |
|
SC324241 | OLAH (untagged)-Human oleoyl-ACP hydrolase (OLAH), transcript variant 2 |
CNY 2,400.00 |