Angiopoietin like 4 (ANGPTL4) (NM_001039667) Human Untagged Clone

CAT#: SC310759

ANGPTL4 (untagged)-Human angiopoietin-like 4 (ANGPTL4), transcript variant 3



  "NM_001039667" in other vectors (4)

CNY 5,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit anti-ANGPTL4 Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 2,700.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARP4; FIAF; HARP; HFARP; NL2; PGAR; pp1158; TGQTL; UNQ171
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC310759 representing NM_001039667.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCGGTGCTCCGACGGCCGGGGCAGCCCTGATGCTCTGCGCCGCCACCGCCGTGCTACTGAGCGCT
CAGGGCGGACCCGTGCAGTCCAAGTCGCCGCGCTTTGCGTCCTGGGACGAGATGAATGTCCTGGCGCAC
GGACTCCTGCAGCTCGGCCAGGGGCTGCGCGAACACGCGGAGCGCACCCGCAGTCAGCTGAGCGCGCTG
GAGCGGCGCCTGAGCGCGTGCGGGTCCGCCTGTCAGGGAACCGAGGGGTCCACCGACCTCCCGTTAGCC
CCTGAGAGCCGGGTGGACCCTGAGGTCCTTCACAGCCTGCAGACACAACTCAAGGCTCAGAACAGCAGG
ATCCAGCAACTCTTCCACAAGGTGGCCCAGCAGCAGCGGCACCTGGAGAAGCAGCACCTGCGAATTCAG
CATCTGCAAAGCCAGTTTGGCCTCCTGGACCACAAGCACCTAGACCATGAGGTGGCCAAGCCTGCCCGA
AGAAAGAGGCTGCCCGAGATGGCCCAGCCAGTTGACCCGGCTCACAATGTCAGCCGCCTGCACCATGGA
GGCTGGACAGTAATTCAGAGGCGCCACGATGGCTCAGTGGACTTCAACCGGCCCTGGGAAGCCTACAAG
GCGGGGTTTGGGGATCCCCACGGCGAGTTCTGGCTGGGTCTGGAGAAGGTGCATAGCATCACGGGGGAC
CGCAACAGCCGCCTGGCCGTGCAGCTGCGGGACTGGGATGGCAACGCCGAGTTGCTGCAGTTCTCCGTG
CACCTGGGTGGCGAGGACACGGCCTATAGCCTGCAGCTCACTGCACCCGTGGCCGGCCAGCTGGGCGCC
ACCACCGTCCCACCCAGCGGCCTCTCCGTACCCTTCTCCACTTGGGACCAGGATCACGACCTCCGCAGG
GACAAGAACTGCGCCAAGAGCCTCTCTGGAGGCTGGTGGTTTGGCACCTGCAGCCATTCCAACCTCAAC
GGCCAGTACTTCCGCTCCATCCCACAGCAGCGGCAGAAGCTTAAGAAGGGAATCTTCTGGAAGACCTGG
CGGGGCCGCTACTACCCGCTGCAGGCCACCACCATGTTGATCCAGCCCATGGCAGCAGAGGCAGCCTCC
TAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001039667
Insert Size 1107 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001039667.2
RefSeq Size 1791 bp
RefSeq ORF 1107 bp
Locus ID 51129
UniProt ID Q9BY76
Protein Families Druggable Genome, Secreted Protein
Protein Pathways PPAR signaling pathway
MW 40.9 kDa
Gene Summary This gene encodes a glycosylated, secreted protein containing a C-terminal fibrinogen domain. The encoded protein is induced by peroxisome proliferation activators and functions as a serum hormone that regulates glucose homeostasis, lipid metabolism, and insulin sensitivity. This protein can also act as an apoptosis survival factor for vascular endothelial cells and can prevent metastasis by inhibiting vascular growth and tumor cell invasion. The C-terminal domain may be proteolytically-cleaved from the full-length secreted protein. Decreased expression of this gene has been associated with type 2 diabetes. Alternative splicing results in multiple transcript variants. This gene was previously referred to as ANGPTL2 but has been renamed ANGPTL4. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (3) lacks an alternate in-frame exon compared to variant 1. The encoded isoform (b) is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...