United States
Germany
Japan
United Kingdom
China
DR3 (TNFRSF25) (NM_001039664) Human Untagged Clone
CAT＃: SC310758
TNFRSF25 (untagged)-Human tumor necrosis factor receptor superfamily, member 25 (TNFRSF25), transcript variant 12
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | APO-3; DDR3; DR3; GEF720; LARD; PLEKHG5; TNFRSF12; TR3; TRAMP; WSL-1; WSL-LR |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001039664, the custom clone sequence may differ by one or more nucleotides
ATGGAGCAGCGGCCGCGGGGCTGCGCGGCGGTGGCGGCGGCGCTCCTCCTGGTGCTGCTG GGGGCCCGGGCCCAGGGCGGCACTCGTAGCCCCAGGTGTGACTGTGCCGGTGACTTCCAC AAGAAGATTGGTCTGTTTTGTTGCAGAGGCTGCCCAGCGGGGCACTACCTGAAGGCCCCT TGCACGGAGCCCTGCGGCAACTCCACCTGCCTTGTGTGTCCCCAAGACACCTTCTTGGCC TGGGAGAACCACCATAATTCTGAATGTGCCCGCTGCCAGGCCTGTGATGAGCAGGCCTCC CAGGTGGCGCTGGAGAACTGTTCAGCAGTGGCCGACACCCGCTGTGGCTGTAAGCCAGGC TGGTTTGTGGAGTGCCAGGTCAGCCAATGTGTCAGCAGTTCACCCTTCTACTGCCAACCA TGCCTAGACTGCGGGGCCCTGCACCGCCACACACGGCTACTCTGTTCCCGCAGAGATACT GACTGTGGGACCTGCCTGCCTGGCTTCTATGAACATGGCGATGGCTGCGTGTCCTGCCCC ACGTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001039664 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001039664.1, NP_001034753.1 |
| RefSeq Size | 894 bp |
| RefSeq ORF | 546 bp |
| Locus ID | 8718 |
| UniProt ID | Q93038 |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | Cytokine-cytokine receptor interaction |
| Gene Summary | The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is expressed preferentially in the tissues enriched in lymphocytes, and it may play a role in regulating lymphocyte homeostasis. This receptor has been shown to stimulate NF-kappa B activity and regulate cell apoptosis. The signal transduction of this receptor is mediated by various death domain containing adaptor proteins. Knockout studies in mice suggested the role of this gene in the removal of self-reactive T cells in the thymus. Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported, most of which are potentially secreted molecules. The alternative splicing of this gene in B and T cells encounters a programmed change upon T-cell activation, which predominantly produces full-length, membrane bound isoforms, and is thought to be involved in controlling lymphocyte proliferation induced by T-cell activation. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (12) lacks several 3' exons and has an alternate 3' end, when compared to variant 1. The resulting isoform (12) has a distinct and shorter C-terminus, as compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212175 | TNFRSF25 (Myc-DDK-tagged)-Human tumor necrosis factor receptor superfamily, member 25 (TNFRSF25), transcript variant 12 |
CNY 3,990.00 |
|
| RC212175L3 | Lenti-ORF clone of TNFRSF25 (Myc-DDK-tagged)-Human tumor necrosis factor receptor superfamily, member 25 (TNFRSF25), transcript variant 12 |
CNY 5,890.00 |
|
| RC212175L4 | Lenti-ORF clone of TNFRSF25 (mGFP-tagged)-Human tumor necrosis factor receptor superfamily, member 25 (TNFRSF25), transcript variant 12 |
CNY 5,890.00 |
|
| RG212175 | TNFRSF25 (tGFP-tagged) - Human tumor necrosis factor receptor superfamily, member 25 (TNFRSF25), transcript variant 12 |
CNY 4,370.00 |
