United States
Germany
Japan
United Kingdom
China
DUSP10 (NM_144729) Human Untagged Clone
CAT＃: SC310672
DUSP10 (untagged)-Human dual specificity phosphatase 10 (DUSP10), transcript variant 3
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | MKP-5; MKP5 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC310672 representing NM_144729.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCAGCGGCTGAACATCGGCTACGTCATCAACGTCACCACTCATCTTCCCCTCTACCACTATGAGAAA GGCCTGTTCAACTACAAGCGGCTGCCAGCCACTGACAGCAACAAGCAGAACCTGCGGCAGTACTTTGAA GAGGCTTTTGAGTTCATTGAGGAAGCTCACCAGTGTGGGAAGGGGCTTCTCATCCACTGCCAGGCTGGG GTGTCCCGCTCCGCCACCATCGTCATCGCTTACTTGATGAAGCACACTCGGATGACCATGACTGATGCT TATAAATTTGTCAAAGGCAAACGACCAATTATCTCCCCAAACCTTAACTTCATGGGGCAGTTGCTAGAG TTCGAGGAAGACCTAAACAACGGTGTGACACCGAGAATCCTTACACCAAAGCTGATGGGCGTGGAGACG GTTGTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_144729 |
| Insert Size | 423 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_144729.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_144729.2 |
| RefSeq Size | 1824 bp |
| RefSeq ORF | 423 bp |
| Locus ID | 11221 |
| Domains | DSPc |
| Protein Families | Druggable Genome, Phosphatase |
| Protein Pathways | MAPK signaling pathway |
| MW | 16.1 kDa |
| Gene Summary | Dual specificity protein phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the MAP kinase superfamily, which is associated with cellular proliferation and differentiation. Different members of this family of dual specificity phosphatases show distinct substrate specificities for MAP kinases, different tissue distribution and subcellular localization, and different modes of expression induction by extracellular stimuli. This gene product binds to and inactivates p38 and SAPK/JNK. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (3) differs in the 5' UTR and coding region compared to variant 1, resulting in an isoform (b) that is shorter at the N-terminus compared to isoform a. Both variants 2 and 3 encode isoform b. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC211820 | DUSP10 (Myc-DDK-tagged)-Human dual specificity phosphatase 10 (DUSP10), transcript variant 3 |
CNY 3,656.00 |
|
| RC211820L3 | Lenti ORF clone of Human dual specificity phosphatase 10 (DUSP10), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC211820L4 | Lenti ORF clone of Human dual specificity phosphatase 10 (DUSP10), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG211820 | DUSP10 (tGFP-tagged) - Human dual specificity phosphatase 10 (DUSP10), transcript variant 3 |
CNY 4,370.00 |
