IMMP2L (NM_032549) Human Untagged Clone
CAT#: SC310646
IMMP2L (untagged)-Human IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) (IMMP2L), nuclear gene encoding mitochondrial protein
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | IMMP2L-IT1; IMP2; IMP2-LIKE |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC310646 representing NM_032549.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCACAGTCACAAGGGTGGGTGAAAAGATACATCAAGGCCTTTTGTAAAGGCTTCTTTGTGGCGGTG CCTGTGGCAGTGACTTTCTTGGATCGGGTCGCCTGTGTGGCAAGAGTAGAAGGAGCATCGATGCAGCCT TCTTTGAATCCTGGGGGGAGCCAGTCATCTGATGTGGTGCTTTTGAACCACTGGAAAGTGAGGAATTTT GAAGTACACCGTGGTGACATTGTATCATTGGTGTCTCCTAAAAACCCAGAACAGAAGATCATTAAGAGA GTGATTGCTCTTGAAGGAGATATTGTCAGAACCATAGGACACAAAAACCGGTATGTCAAAGTCCCCCGT GGTCACATCTGGGTTGAAGGTGATCATCATGGACACAGTTTTGACAGTAATTCTTTTGGGCCGGTTTCC CTAGGACTTCTGCATGCCCATGCCACACATATCCTGTGGCCCCCAGAGCGCTGGCAGAAATTGGAATCT GTTCTTCCTCCAGAGCGCTTACCAGTACAGAGAGAAGAGGAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_032549 |
Insert Size | 528 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_032549.3 |
RefSeq Size | 1539 bp |
RefSeq ORF | 528 bp |
Locus ID | 83943 |
UniProt ID | Q96T52 |
Domains | Peptidase_S26 |
Protein Families | Druggable Genome, Protease |
MW | 19.7 kDa |
Gene Summary | This gene encodes a protein involved in processing the signal peptide sequences used to direct mitochondrial proteins to the mitochondria. The encoded protein resides in the mitochondria and is one of the necessary proteins for the catalytic activity of the mitochondrial inner membrane peptidase (IMP) complex. Two variants that encode the same protein have been described for this gene. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (1), as well as variants 2-4, encodes isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215438 | IMMP2L (Myc-DDK-tagged)-Human IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) (IMMP2L), nuclear gene encoding mitochondrial protein |
CNY 3,600.00 |
|
RC215438L3 | Lenti ORF clone of Human IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) (IMMP2L), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC215438L4 | Lenti ORF clone of Human IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) (IMMP2L), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5,890.00 |
|
RG215438 | IMMP2L (tGFP-tagged) - Human IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) (IMMP2L), nuclear gene encoding mitochondrial protein |
CNY 5,200.00 |