CATSPER2 (NM_172097) Human Untagged Clone
CAT#: SC310631
CATSPER2 (untagged)-Human cation channel, sperm associated 2 (CATSPER2), transcript variant 4
"NM_172097" in other vectors (4)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MGC33346 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_172097, the custom clone sequence may differ by one or more nucleotides
ATGGCCGCTTACCAACAAGAAGAGCAGATGCAGCTTCCCCGAGCTGATGCCATTCGTTCA CGTCTCATCGATACTTTCTCTCTCATTGAGCATTTGCAAGGCTTGAGCCAAGCTGTGCCG CGGCACACTATCAGGGAGTTACTTGATCCTTCCCGCCAGAAGAAACTTGTATTGGGAGAT CAACACCAGCTAGTGCGTTTCTCTATAAAGCCTCAGCGTATAGAACAGATTTCACATGCC CAGAGGCTGTTGAGCAGGCTTCATGTGCGCTGCAGTCAGAGGCCACCTCTTTCTTTGTGG GCCGGATGGGTCCTTGAGTGTCCTCTCTTCAAAAACTTCATCATCTTCCTGGTCTTTTTG AATACGATCATATTGATGGTTGAAATAGAATTGCTGGAATCCACAAATACCAAACTATGG CCATTGAAGCTGACCTTGGAGGTGGCAGCTTGGTTTATCTTGCTTATTTTCATCCTGGAG ATCCTTCTTAAGTGGCTATCCAACTTTTCTGTTTTCTGGAAGAGTGCCTGGAATGTCTTT GACTTTGTTGTTACCATGTTGGTAAGGATAGAGATCCTGAGGGTTCGTTTAGTGGGATGA |
Restriction Sites | Please inquire |
ACCN | NM_172097 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_172097.1, NP_742095.1 |
RefSeq Size | 1678 bp |
RefSeq ORF | 600 bp |
Locus ID | 117155 |
Protein Families | Druggable Genome, Ion Channels: Other, Transmembrane |
Gene Summary | This gene encodes a member of a family of cation channel proteins that localize to the flagellum of spermatozoa. Defects at this locus causes male infertility. Alternatively spliced transcript variants have been observed at this locus. Readthrough transcription originates upstream of this locus in diphosphoinositol pentakisphosphate kinase 1 pseudogene 1 and is represented by GeneID:110006325. Related pseudogenes are found next to this locus on chromosome 15 and on chromosome 5. [provided by RefSeq, Mar 2017] Transcript Variant: This variant (4) differs in both UTR's and the coding region but maintains the reading frame, compared to variant 5. This results in a protein that is shorter at both the N- and C-termini, compared to isoform 5. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216311 | CATSPER2 (Myc-DDK-tagged)-Human cation channel, sperm associated 2 (CATSPER2), transcript variant 4 |
CNY 3,990.00 |
|
RC216311L3 | Lenti-ORF clone of CATSPER2 (Myc-DDK-tagged)-Human cation channel, sperm associated 2 (CATSPER2), transcript variant 4 |
CNY 5,890.00 |
|
RC216311L4 | Lenti-ORF clone of CATSPER2 (mGFP-tagged)-Human cation channel, sperm associated 2 (CATSPER2), transcript variant 4 |
CNY 5,890.00 |
|
RG216311 | CATSPER2 (tGFP-tagged) - Human cation channel, sperm associated 2 (CATSPER2), transcript variant 4 |
CNY 4,370.00 |
其它CATSPER2产品