United States
Germany
Japan
United Kingdom
China
RHBDL2 (NM_017821) Human Untagged Clone
CAT＃: SC310551
RHBDL2 (untagged)-Human rhomboid, veinlet-like 2 (Drosophila) (RHBDL2)
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | RRP2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_017821, the custom clone sequence may differ by one or more nucleotides
ATGGCTGCTGTTCATGATCTGGAGATGGAGAGCATGAATCTGAATATGGGGAGAGAGATGAAAGAAGAGC TGGAGGAAGAGGAGAAAATGAGAGAGGATGGGGGAGGTAAAGATCGGGCCAAGAGTAAAAAGGTCCACAG GATTGTCTCAAAATGGATGCTGCCCGAAAAGTCCCGAGGAACATACTTGGAGAGAGCTAACTGCTTCCCG CCTCCCGTGTTCATCATCTCCATCAGCCTGGCCGAGCTGGCAGTGTTTATTTACTATGCTGTGTGGAAGC CTCAGAAACAGTGGATCACGTTGGACACAGGCATCTTGGAGAGTCCCTTTATCTACAGTCCTGAGAAGAG GGAGGAAGCCTGGAGGTTTATCTCATACATGCTGGTACATGCTGGAGTTCAGCACATCTTGGGGAATCTT TGTATGCAGCTTGTTTTGGGTATTCCCTTGGAAATGGTCCACAAAGGCCTCCGTGTGGGGCTGGTGTACC TGGCAGGAGTGATTGCAGGGTCCCTTGCCAGCTCCATCTTTGACCCACTCAGATATCTTGTGGGAGCTTC AGGAGGAGTCTATGCTCTGATGGGAGGCTATTTTATGAATGTTCTGGTGAATTTTCAAGAAATGATTCCT GCCTTTGGAATTTTCAGACTGCTGATCATCATCCTGATAATTGTGTTGGACATGGGATTTGCTCTCTATA GAAGGTTCTTTGTTCCTGAAGATGGGTCTCCGGTGTCTTTTGCAGCTCACATTGCAGGTGGATTTGCTGG AATGTCCATTGGCTACACGGTGTTTAGCTGCTTTGATAAAGCACTGCTGAAAGATCCAAGGTTTTGGATA GCAATTGCTGCATATTTAGCTTGTGTCTTATTTGCTGTGTTTTTCAACATTTTCCTATCTCCAGCAAACT GA |
| Restriction Sites | Please inquire |
| ACCN | NM_017821 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_017821.3, NP_060291.2 |
| RefSeq Size | 1838 bp |
| RefSeq ORF | 912 bp |
| Locus ID | 54933 |
| UniProt ID | Q9NX52 |
| Protein Families | Protease, Transmembrane |
| Gene Summary | The protein encoded by this gene is a member of the rhomboid family of integral membrane proteins. This family contains proteins that are related to Drosophila rhomboid protein. Members of this family are found in both prokaryotes and eukaryotes and are thought to function as intramembrane serine proteases. The encoded protein is thought to release soluble growth factors by proteolytic cleavage of certain membrane-bound substrates, including ephrin B2 and ephrin B3. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2015] Transcript Variant: This variant (2) uses an alternate first exon in place of that of variant 1, which results in variant 2 using a downstream translation start site compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219882 | RHBDL2 (Myc-DDK-tagged)-Human rhomboid, veinlet-like 2 (Drosophila) (RHBDL2) |
CNY 3,600.00 |
|
| RC219882L1 | Lenti ORF clone of Human rhomboid, veinlet-like 2 (Drosophila) (RHBDL2), Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC219882L2 | Lenti ORF clone of Human rhomboid, veinlet-like 2 (Drosophila) (RHBDL2), mGFP tagged |
CNY 5,890.00 |
|
| RC219882L3 | Lenti ORF clone of Human rhomboid, veinlet-like 2 (Drosophila) (RHBDL2), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC219882L4 | Lenti ORF clone of Human rhomboid, veinlet-like 2 (Drosophila) (RHBDL2), mGFP tagged |
CNY 5,890.00 |
|
| RG219882 | RHBDL2 (tGFP-tagged) - Human rhomboid, veinlet-like 2 (Drosophila) (RHBDL2) |
CNY 4,370.00 |
