United States
Germany
Japan
United Kingdom
China
DC2L1 (DYNC2LI1) (NM_016008) Human Untagged Clone
CAT＃: SC310512
DYNC2LI1 (untagged)-Human dynein, cytoplasmic 2, light intermediate chain 1 (DYNC2LI1), transcript variant 1
CNY 7,220.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CGI-60; D2LIC; LIC3 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_016008, the custom clone sequence may differ by one or more nucleotides
ATGCCCAGTGAAACTCTCTGGGAAATTGCAAAAGCTGAAGTGGAAAAAAGGGGAATTAAT GGAAGTGAAGGTGATGGAGCTGAAATTGCAGAAAAATTTGTTTTCTTCATTGGCAGTAAA AATGGGGGAAAGACTACTATTATTCTAAGGTGTCTTGACAGAGATGAACCACCAAAACCA ACCTTAGCTTTGGAATATACATATGGAAGAAGAGCAAAAGGGCACAACACACCAAAAGAT ATCGCTCACTTTTGGGAACTCGGTGGAGGAACCTCTTTATTGGACTTAATCAGCATACCC ATCACAGGTGACACCTTACGGACGTTTTCTCTTGTTCTCGTTCTGGATCTTTCAAAACCT AATGATCTCTGGCCCACCATGGAAAATCTCTTGCAAGCCACAAAAAGCCATGTAGACAAA GTGATAATGAAACTGGGAAAGACAAATGCTAAAGCAGTTTCTGAAATGAGACAGAAGATC TGGAATAATATGCCGAAGGATCATCCTGATCATGAATTAATTGACCCATTTCCGGTACCT CTGGTCATAATTGGAAGTAAATATGATGTTTTTCAGGATTTTGAGTCTGAGAAGAGAAAG GTAATATGCAAGACACTTCGATTTGTTGCACATTATTATGGAGCATCATTAATGTTTACC AGTAAATCAGAAGCTCTATTACTAAAAATACGTGGAGTTATCAACCAGTTGGCATTTGGC ATTGACAAAAGCAAATCAATATGTGTGGATCAGAATAAACCGCTGTTTATCACAGCAGGA TTGGATTCTTTCGGTCAAATAGGATCTCCTCCTGTTCCTGAAAATGACATTGGAAAGCTT CATGCCCACTCACCTATGGAGTTGTGGAAAAAAGTGTATGAAAAGCTCTTTCCACCAAAG AGTATTAACACGCTGAAAGATATCAAGGACCCTGCGAGAGATCCTCAGTATGCTGAAAAT GAAGTCGATGAGATGAGAATTCAGAAGGATCTGGAACTGGAACAGTACAAAAGAAGTTCT TCCAAGTCTTGGAAACAAATCGAGCTTGATTCTTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_016008 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_016008.2, NP_057092.2 |
| RefSeq Size | 1404 bp |
| RefSeq ORF | 1056 bp |
| Locus ID | 51626 |
| UniProt ID | Q8TCX1 |
| Gene Summary | This gene encodes a protein that is a component of the dynein-2 microtubule motor protein complex that plays a role in the retrograde transport of cargo in primary cilia via the intraflagellar transport system. This gene is ubiquitously expressed and its protein, which localizes to the axoneme and Golgi apparatus, interacts directly with the cytoplasmic dynein 2 heavy chain 1 protein to form part of the multi-protein dynein-2 complex. Mutations in this gene produce defects in the dynein-2 complex which result in several types of ciliopathy including short-rib thoracic dysplasia 15 with polydactyly (SRTD15). Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017] Transcript Variant: This variant (1) encodes isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202656 | DYNC2LI1 (Myc-DDK-tagged)-Human dynein, cytoplasmic 2, light intermediate chain 1 (DYNC2LI1), transcript variant 1 |
CNY 3,990.00 |
|
| RC202656L3 | Lenti-ORF clone of DYNC2LI1 (Myc-DDK-tagged)-Human dynein, cytoplasmic 2, light intermediate chain 1 (DYNC2LI1), transcript variant 1 |
CNY 5,890.00 |
|
| RC202656L4 | Lenti-ORF clone of DYNC2LI1 (mGFP-tagged)-Human dynein, cytoplasmic 2, light intermediate chain 1 (DYNC2LI1), transcript variant 1 |
CNY 5,890.00 |
|
| RG202656 | DYNC2LI1 (tGFP-tagged) - Human dynein, cytoplasmic 2, light intermediate chain 1 (DYNC2LI1), transcript variant 1 |
CNY 4,370.00 |
|
| SC321051 | DYNC2LI1 (untagged)-Human dynein, cytoplasmic 2, light intermediate chain 1 (DYNC2LI1), transcript variant 1 |
CNY 3,656.00 |
其它DYNC2LI1产品
