SAPK3 (MAPK12) (NM_002969) Human Untagged Clone

CAT#: SC310481

MAPK12 (untagged)-Human mitogen-activated protein kinase 12 (MAPK12)



  "NM_002969" in other vectors (7)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-MAPK12 (SAPK3) mouse monoclonal antibody, clone OTI10E1 (formerly 10E1)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ERK-6; ERK3; ERK6; MAPK 12; P38GAMMA; PRKM12; SAPK-3; SAPK3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC310481 representing NM_002969.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCTCTCCGCCGCCCGCCCGCAGTGGCTTTTACCGCCAGGAGGTGACCAAGACGGCCTGGGAGGTG
CGCGCCGTGTACCGGGACCTGCAGCCCGTGGGCTCGGGCGCCTACGGCGCGGTGTGCTCGGCCGTGGAC
GGCCGCACCGGCGCTAAGGTGGCCATCAAGAAGCTGTATCGGCCTTTCCAGTCCGAGCTGTTCGCCAAG
CGCGCCTACCGCGAGCTGCGCCTGCTCAAGCACATGCGCCACGAGAACGTGATCGGGCTGCTGGACGTA
TTCACTCCTGATGAGACCCTGGATGACTTCACGGACTTTTACCTGGTGATGCCGTTCATGGGCACCGAC
CTGGGCAAGCTCATGAAACATGAGAAGCTAGGCGAGGACCGGATCCAGTTCCTCGTGTACCAGATGCTG
AAGGGGCTGAGGTATATCCACGCTGCCGGCATCATCCACAGAGACCTGAAGCCCGGCAACCTGGCTGTG
AACGAAGACTGTGAGCTGAAGATCCTGGACTTCGGCCTGGCCAGGCAGGCAGACAGTGAGATGACTGGG
TACGTGGTGACCCGGTGGTACCGGGCTCCCGAGGTCATCTTGAATTGGATGCGCTACACGCAGACGGTG
GACATCTGGTCTGTGGGCTGCATCATGGCGGAGATGATCACAGGCAAGACGCTGTTCAAGGGCAGCGAC
CACCTGGACCAGCTGAAGGAGATCATGAAGGTGACGGGGACGCCTCCGGCTGAGTTTGTGCAGCGGCTG
CAGAGCGATGAGGCCAAGAACTACATGAAGGGCCTCCCCGAATTGGAGAAGAAGGATTTTGCCTCTATC
CTGACCAATGCAAGCCCTCTGGCTGTGAACCTCCTGGAGAAGATGCTGGTGCTGGACGCGGAGCAGCGG
GTGACGGCAGGCGAGGCGCTGGCCCATCCCTACTTCGAGTCCCTGCACGACACGGAAGATGAGCCCCAG
GTCCAGAAGTATGATGACTCCTTTGACGACGTTGACCGCACACTGGATGAATGGAAGCGTGTTACTTAC
AAAGAGGTGCTCAGCTTCAAGCCTCCCCGGCAGCTGGGGGCCAGGGTCTCCAAGGAGACGCCTCTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_002969
Insert Size 1104 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002969.4
RefSeq Size 1877 bp
RefSeq ORF 1104 bp
Locus ID 6300
UniProt ID P53778
Domains pkinase, TyrKc, S_TKc
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Amyotrophic lateral sclerosis (ALS), Epithelial cell signaling in Helicobacter pylori infection, Fc epsilon RI signaling pathway, GnRH signaling pathway, Leukocyte transendothelial migration, MAPK signaling pathway, Neurotrophin signaling pathway, NOD-like receptor signaling pathway, Oocyte meiosis, Progesterone-mediated oocyte maturation, RIG-I-like receptor signaling pathway, T cell receptor signaling pathway, Toll-like receptor signaling pathway, VEGF signaling pathway
MW 41.9 kDa
Gene Summary Activation of members of the mitogen-activated protein kinase family is a major mechanism for transduction of extracellular signals. Stress-activated protein kinases are one subclass of MAP kinases. The protein encoded by this gene functions as a signal transducer during differentiation of myoblasts to myotubes. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...