GTF2A1 (NM_015859) Human Untagged Clone
CAT#: SC310468
GTF2A1 (untagged)-Human general transcription factor IIA, 1, 19/37kDa (GTF2A1), transcript variant 1
CNY 7,220.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | TF2A1; TFIIA; TFIIA-42; TFIIAL |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_015859, the custom clone sequence may differ by one or more nucleotides
ATGGCGAACTCGGCAAATACAAACACCGTGCCTAAATTATACAGATCTGTGATTGAAGAT GTCATTAATGATGTGAGAGACATCTTTCTGGATGATGGAGTGGATGAACAAGTACTGATG GAACTAAAAACTTTATGGGAAAACAAACTAATGCAGTCCAGGGCAGTAGATGGATTTCAT TCAGAAGAGCAGCAGCTTCTACTGCAAGTTCAACAGCAGCATCAACCCCAGCAGCAGCAG CATCACCACCATCACCATCATCAGCAAGCTCAGCCTCAGCAGACAGTACCTCAGCAAGCG CAGACCCAGCAGGTTCTTATTCCTGCATCACAGCAAGCCACAGCACCACAAGTTATTGTT CCAGATTCTAAGTTGATACAGCATATGAATGCATCAAACATGAGTGCTGCTGCTACAGCT GCTACCTTAGCACTCCCTGCAGGTGTGACTCCTGTTCAGCAGATATTAACAAATTCAGGC CAGCTTCTTCAGGTGGTCAGAGCAGCCAATGGTGCCCAATATATCTTTCAGCCTCAGCAG TCAGTGGTTCTACAACAACAGGTTATACCACAAATGCAGCCTGGTGGAGTACAAGCTCCT GTTATACAGCAGGTGCTGGCTCCTCTTCCTGGAGGGATTTCACCACAGACAGGTGTCATC ATCCAGCCTCAGCAAATCTTATTTACAGGAAATAAGACTCAAGTTATACCTACGACAGTG GCAGCACCTACACCAGCCCAAGCACAGATAACTGCAACTGGCCAGCAGCAACCGCAGGCC CAGCCTGCTCAAACACAAGCTCCATTGGTCTTACAAGTTGATGGAACTGGGGATACATCA TCTGAAGAAGATGAAGATGAAGAAGAAGACTATGATGATGATGAGGAGGAAGACAAAGAG AAAGATGGAGCTGAAGATGGGCAGGTGGAAGAAGAGCCCCTCAATAGTGAAGATGATGTG AGTGATGAGGAAGGACAGGAACTCTTTGACACAGAAAATGTTGTTGTATGCCAATATGAT AAGATACACAGAAGTAAAAACAAATGGAAATTTCATCTCAAGGATGGCATTATGAATCTT AATGGAAGAGATTATATATTTTCCAAAGCCATTGGAGATGCAGAATGGTGA |
Restriction Sites | Please inquire |
ACCN | NM_015859 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_015859.2, NP_056943.1 |
RefSeq Size | 1736 bp |
RefSeq ORF | 1131 bp |
Locus ID | 2957 |
UniProt ID | P52655 |
Domains | TFIIA |
Protein Families | Transcription Factors |
Protein Pathways | Basal transcription factors |
Gene Summary | Accurate transcription initiation on TATA-containing class II genes involves the ordered assembly of RNA polymerase II (POLR2A; MIM 180660) and several general initiation factors (summarized by DeJong and Roeder, 1993 [PubMed 8224848]). One of these factors is TFIIA, which when purified from HeLa extracts consists of 35-, 19-, and 12-kD subunits.[supplied by OMIM, Jul 2010] Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224564 | GTF2A1 (Myc-DDK-tagged)-Human general transcription factor IIA, 1, 19/37kDa (GTF2A1), transcript variant 1 |
CNY 3,990.00 |
|
RC224564L3 | Lenti-ORF clone of GTF2A1 (Myc-DDK-tagged)-Human general transcription factor IIA, 1, 19/37kDa (GTF2A1), transcript variant 1 |
CNY 5,890.00 |
|
RC224564L4 | Lenti-ORF clone of GTF2A1 (mGFP-tagged)-Human general transcription factor IIA, 1, 19/37kDa (GTF2A1), transcript variant 1 |
CNY 5,890.00 |
|
RG224564 | GTF2A1 (tGFP-tagged) - Human general transcription factor IIA, 1, 19/37kDa (GTF2A1), transcript variant 1 |
CNY 4,370.00 |