SUV420h1 (KMT5B) (NM_016028) Human Untagged Clone
CAT#: SC310445
SUV420H1 (untagged)-Human suppressor of variegation 4-20 homolog 1 (Drosophila) (SUV420H1), transcript variant 2
CN¥ 3,656.00
CN¥ 6,370.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CGI-85; CGI85; MRD51; SUV420H1 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_016028 edited
ATGAAGTGGTTGGGAGAATCCGAGAACATGGTGGTGAATGGCAGGAGAAATGGAGGCAAG TTGTCTAATGACCATCAGCAGAATCAATCAAAATTACAGCACACGGGGAAGGACACCCTG AAGGCTGGCAAAAATGCAGTCGAGAGGAGGTCGAACAGATGTAATGGTAACTCGGGATTT GAAGGACAGAGTCGCTATGTACCATCCTCTGGAATGTCCGCCAAGGAACTCTGTGAAAAT GATGACCTAGCAACCAGTTTGGTTCTTGATCCCTATTTAGGTTTTCAAACACACAAAATG AATACTAGCGCCTTTCCTTCGAGGAGCTCAAGGCATTTTTCAAAATCTGACAGTTTTTCT CACAACAACCCTGTGAGATTTAGGCCTATTAAAGGAAGGCAGGAAGAACTAAAGGAAGTA ATTGAACGTTTTAAGAAAGATGAACACTTGGAGAAAGCCTTCAAATGTTTGACTTCAGGC GAATGGGCACGGCACTATTTTCTCAACAAGAATAAAATGCAGGAGAAATTATTCAAAGAA CATGTATTTATTTATTTGCGAATGTTTGCAACTGACAGTGGATTTGAAATATTGCCATGT AATAGATACTCATCAGAACAAAATGGAGCCAAAATAGTTGCAACAAAAGAGTGGAAACGA AATGACAAAATAGAATTACTGGTGGGTTGTATTGCCGAACTTTCAGAAATTGAGGAGAAC ATGCTACTTAGACATGGAGAAAACGACTTCAGTGTCATGTACTCCACAAGGAAAAACTGT GCTCAACTCTGGCTGGGTCCTGCTGCGTTTATAAACCATGATTGCAGACCTAATTGTAAG TTTGTGTCAACTGGTCGAGATACAGCATGTGTGAAGGCTCTAAGAGACATTGAACCTGGA GAAGAAATTTCTTGTTATTATGGAGATGGGTTCTTTGGAGAAAATAATGAGTTCTGCGAG TGTTACACTTGCGAAAGACGGGGCACTGGTGCTTTTAAATCCAGAGTGGGACTGCCTGCG CCTGCTCCTGTTATCAATAGCAAATATGGACTCAGAGAAACAGATAAACGTTTAAATAGG CTTAAAAAGTTAGGTGACAGCAGCAAAAATTCAGACAGTCAATCTGTCAGCTCTAACACT GATGCAGATACCACTCAGGAAAAAAACAATGCAAGTAAGTAA |
Restriction Sites | NotI-NotI |
ACCN | NM_016028 |
Insert Size | 2400 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_016028.4. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_016028.4, NP_057112.3 |
RefSeq Size | 2711 bp |
RefSeq ORF | 1182 bp |
Locus ID | 51111 |
UniProt ID | Q4FZB7 |
Domains | SET |
Protein Families | Druggable Genome |
Protein Pathways | Lysine degradation |
Gene Summary | This gene encodes a protein that contains a SET domain. SET domains appear to be protein-protein interaction domains that mediate interactions with a family of proteins that display similarity with dual-specificity phosphatases (dsPTPases). The function of this gene has not been determined. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (2) has an alternate 3' exon and utilizes an upstream stop codon, compared to variant 1. The resulting isoform (2) is shorter and has a distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221306 | SUV420H1 (Myc-DDK-tagged)-Human suppressor of variegation 4-20 homolog 1 (Drosophila) (SUV420H1), transcript variant 2 |
CN¥ 3,656.00 |
|
RC221306L1 | Lenti-ORF clone of SUV420H1 (Myc-DDK-tagged)-Human suppressor of variegation 4-20 homolog 1 (Drosophila) (SUV420H1), transcript variant 2 |
CN¥ 6,056.00 |
|
RC221306L2 | Lenti-ORF clone of SUV420H1 (mGFP-tagged)-Human suppressor of variegation 4-20 homolog 1 (Drosophila) (SUV420H1), transcript variant 2 |
CN¥ 5,890.00 |
|
RC221306L3 | Lenti-ORF clone of SUV420H1 (Myc-DDK-tagged)-Human suppressor of variegation 4-20 homolog 1 (Drosophila) (SUV420H1), transcript variant 2 |
CN¥ 5,890.00 |
|
RC221306L4 | Lenti-ORF clone of SUV420H1 (mGFP-tagged)-Human suppressor of variegation 4-20 homolog 1 (Drosophila) (SUV420H1), transcript variant 2 |
CN¥ 5,890.00 |
|
RG221306 | SUV420H1 (tGFP-tagged) - Human suppressor of variegation 4-20 homolog 1 (Drosophila) (SUV420H1), transcript variant 2 |
CN¥ 4,370.00 |
其它SUV420h1产品