CYP2A7 (NM_030589) Human Untagged Clone
CAT#: SC310385
CYP2A7 (untagged)-Human cytochrome P450, family 2, subfamily A, polypeptide 7 (CYP2A7), transcript variant 2
CNY 7,130.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CPA7; CPAD; CYP2A; CYPIIA7; P450-IIA4 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_030589, the custom clone sequence may differ by one or more nucleotides
ATGCTGGCCTCAGGGCTGCTTCTGGTGGCCTTGCTGGCCTGCCTGACTGTGATGGTCTTG ATGTCTGTCTGGCAGCAGAGGAAGAGCAGGGGGAAGCTGCCTCCGGGACCCACCCCACTG CCCTTCATTGGAAACTACCTCCAGCTGAACACAGAGCACATATGTGACTCCATCATGAAG GTGTCCCAAGGCGTGGCGTTCAGCAACGGGGAGCGCGCCAAGCAGCTCCTGCGCTTTGCC ATCGCCACCCTGAGGGACTTCGGGGTGGGCAAGCGAGGCATCGAGGAGCGCATCCAGGAG GAGTCGGGCTTCCTCATCGAGGCCATCCGGAGCACGCACGGCGCCAATATCGATCCCACC TTCTTCCTGAGCCGCACAGTCTCCAATGTCATCAGCTCCATTGTCTTTGGGGACCGCTTT GACTATGAGGACAAAGAGTTCCTGTCACTGCTGAGCATGATGCTAGGAATCTTCCAGTTC ACGTCAACCTCCACGGGGCAGCTCTATGAGATGTTCTCTTCGGTGATGAAACACCTGCCA GGACCACAGCAACAGGCCTTTAAGTTGCTGCAAGGGCTGGAGGACTTCATAGCCAAGAAG GTGGAGCACAACCAGCGCACGCTGGATCCCAATTCCCCACAGGACTTCATCGACTCCTTT CTCATCCACATGCAGGAGGAGGAGAAGAACCCCAACACGGAGTTCTACTTGAAGAACCTG ATGATGAGCACGTTGAACCTCTTCATTGCAGGCACCGAGACGGTCAGCACCACCCTGCGC TATGGCTTCTTGCTGCTCATGAAGCACCCAGAGGTGGAGGCCAAGGTCCATGAGGAGATT GACAGAGTGATCGGCAAGAACCGGCAGCCCAAGTTTGAGGACCGGACCAAGATGCCCTAC ATGGAGGCAGTGATCCACGAGATCCAAAGATTTGGAGACGTGATCCCCATGAGTTTGGCC CGCAGGGTTAAAAAGGACACCAAGTTTCGGGATTTTTTCCTCCCTAAGGGCACCGAAGTG TTCCCTATGCTGGGCTCCGTGCTGAGAGACCCCAGCTTCTTCTCCAACCCTCAGGACTTC AATCCCCAGCATTTCCTGGATGACAAGGGGCAGTTTAAGAAGAGTGATGCTTTTGTGCCC TTTTCCATCGGAAAGCGGAACTGTTTCGGAGAAGGCCTGGCCAGAATGGAGCTCTTTCTC TTCTTCACCACCGTCATGCAGAACTTCCGCCTCAAGTCCTCCCAGTCACCTAAGGACATT GACGTGTCCCCCAAACACGTGGTCTTTGCCACGATCCCACGAAACTACACCATGAGCTTC CTGCCCCGCTGA |
Restriction Sites | Please inquire |
ACCN | NM_030589 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_030589.2, NP_085079.2 |
RefSeq Size | 2128 bp |
RefSeq ORF | 1332 bp |
Locus ID | 1549 |
UniProt ID | P20853 |
Domains | p450 |
Protein Families | Druggable Genome, P450, Transmembrane |
Protein Pathways | Caffeine metabolism, Drug metabolism - cytochrome P450, Drug metabolism - other enzymes, Metabolic pathways, Retinol metabolism |
Gene Summary | This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum; its substrate has not yet been determined. This gene, which produces two transcript variants, is part of a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2, also known as CYP2A7AS) lacks exon 2 within the coding region and includes 10 nt from intron 1, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. This variant lacks publicly available transcript support but it is supported by data in PubMedID:7864805. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214234 | CYP2A7 (Myc-DDK-tagged)-Human cytochrome P450, family 2, subfamily A, polypeptide 7 (CYP2A7), transcript variant 2 |
CNY 3,656.00 |
|
RC214234L3 | Lenti-ORF clone of CYP2A7 (Myc-DDK-tagged)-Human cytochrome P450, family 2, subfamily A, polypeptide 7 (CYP2A7), transcript variant 2 |
CNY 5,890.00 |
|
RC214234L4 | Lenti-ORF clone of CYP2A7 (mGFP-tagged)-Human cytochrome P450, family 2, subfamily A, polypeptide 7 (CYP2A7), transcript variant 2 |
CNY 5,890.00 |
|
RG214234 | CYP2A7 (tGFP-tagged) - Human cytochrome P450, family 2, subfamily A, polypeptide 7 (CYP2A7), transcript variant 2 |
CNY 5,256.00 |