CDK10 (NM_052987) Human Untagged Clone
CAT#: SC309589
CDK10 (untagged)-Human cyclin-dependent kinase 10 (CDK10), transcript variant b
CN¥ 6,270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ALSAS; PISSLRE |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_052987, the custom clone sequence may differ by one or more nucleotides
ATGGACAAGGAGAAGGATGGCATCCCCATCAGCAGCTTGCGGGAGATCACGCTGCTGCTC CGCCTGCGTCATCCGAACATCGTGGAGCTGAAGGAGGTGGTTGTGGGGAACCACCTGGAG AGCATCTTCCTGGTGATGGGTTACTGTGAGCAGGACCTGGCCAGCCTCCTGGAGAATATG CCAACACCCTTCTCGGAGGCTCAGGTCAAGTGCATCGTGCTGCAGGTGCTCCGGGGCCTC CAGTATCTGCACAGGAACTTCATTATCCACAGGGACCTGAAGGTTTCCAACTTGCTCATG ACCGACAAGGGTTGTGTGAAGACAGCGGATTTCGGCCTGGCCCGGGCCTATGGTGTCCCA GTAAAGCCAATGACCCCCAAGGTGGTCACTCTCTGGTACCGAGCCCCTGAACTGCTGTTG GGAACCACCACGCAGACCACCAGCATCGACATGTGGGCTGTGGGCTGCATACTGGCCGAG CTGCTGGCGCACAGGCCTCTTCTCCCCGGCACTTCCGAGATCCACCAGATCGACTTGATC GTGCAGCTGCTGGGCACGCCCAGTGAGAACATCTGGCCGGGCTTTTCCAAGCTGCCACTG GTCGGCCAGTACAGCCTCCGGAAGCAGCCCTACAACAACCTGAAGCACAAGTTCCCATGG CTGTCGGAGGCCGGGCTGCGCCTGCTGCACTTCCTGTTCATGTACGACCCTAAGAAAAGG GCGACGGCCGGGGACTGCCTGGAGAGCTCCTATTTCAAGGAGAAGCCCCTACGTCTTCCG ATCAGTGGTGTCTGTGAAGGGTGCCGCGAGCCAGGCTGA |
Restriction Sites | Please inquire |
ACCN | NM_052987 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_052987.2, NP_443713.1 |
RefSeq Size | 1633 bp |
RefSeq ORF | 945 bp |
Locus ID | 8558 |
UniProt ID | Q15131 |
Domains | pkinase, TyrKc, S_TKc |
Protein Families | Druggable Genome, Protein Kinase |
Gene Summary | The protein encoded by this gene belongs to the CDK subfamily of the Ser/Thr protein kinase family. The CDK subfamily members are highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, and are known to be essential for cell cycle progression. This kinase has been shown to play a role in cellular proliferation and its function is limited to cell cycle G2-M phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009] Transcript Variant: This variant (b) uses an alternate donor splice site at the first exon resulting in translation from a downstream start codon, and uses an alternate acceptor splice site at the last exon, compared to variant a. The resulting isoform (b) has a shorter N-terminus and a shorter and distinct C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213705 | CDK10 (Myc-DDK-tagged)-Human cyclin-dependent kinase 10 (CDK10), transcript variant b |
CN¥ 3,990.00 |
|
RC213705L3 | Lenti-ORF clone of CDK10 (Myc-DDK-tagged)-Human cyclin-dependent kinase 10 (CDK10), transcript variant b |
CN¥ 5,890.00 |
|
RC213705L4 | Lenti-ORF clone of CDK10 (mGFP-tagged)-Human cyclin-dependent kinase 10 (CDK10), transcript variant b |
CN¥ 5,890.00 |
|
RG213705 | CDK10 (tGFP-tagged) - Human cyclin-dependent kinase 10 (CDK10), transcript variant b |
CN¥ 4,370.00 |