United States
Germany
Japan
United Kingdom
China
NF2 (NM_181833) Human Untagged Clone
CAT＃: SC309525
NF2 (untagged)-Human neurofibromin 2 (merlin) (NF2), transcript variant 9
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ACN; BANF; merlin-1; SCH |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_181833, the custom clone sequence may differ by one or more nucleotides
ATGGCCGGGGCCATCGCTTCCCGCATGAGCTTCAGCTCTCTCAAGAGGAAGCAACCCAAG ACGTTCACCGTGAGGATCGTCACCATGGACGCCGAGATGGAGTTCAATTGCGAGATGAAG TGGAAAGGGAAGGACCTCTTTGATTTGGTGTGCCGGACTCTGGGGCTCCGAGAAACCTGG TTCTTTGGACTGCAGTACACAATCAAGGACACAGTGGCCTGGCTCAAAATGGACAAGAAG GTACTGGATCATGATGTTTCAAAGGAAGAACCAGTCACCTTTCACTTCTTGGCCAAATTT TATCCTGAGAATGCTGAAGAGGAGCTGGTTCAGGAGATCACACAACATTTATTCTTCTTA CAGGTAAAGAAGCAGATTTTAGATGAAAAGATCTACTGCCCTCCTGAGGCTTCTGTGCTC CTGGCTTCTTACGCCGTCCAGGCCAAGCTCACCTTGCAGAGCGCCAAGTCCCGAGTGGCC TTCTTTGAAGAGCTCTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_181833 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_181833.1, NP_861971.1 |
| RefSeq Size | 4731 bp |
| RefSeq ORF | 498 bp |
| Locus ID | 4771 |
| UniProt ID | P35240 |
| Protein Families | Druggable Genome |
| Gene Summary | This gene encodes a protein that is similar to some members of the ERM (ezrin, radixin, moesin) family of proteins that are thought to link cytoskeletal components with proteins in the cell membrane. This gene product has been shown to interact with cell-surface proteins, proteins involved in cytoskeletal dynamics and proteins involved in regulating ion transport. This gene is expressed at high levels during embryonic development; in adults, significant expression is found in Schwann cells, meningeal cells, lens and nerve. Mutations in this gene are associated with neurofibromatosis type II which is characterized by nervous system and skin tumors and ocular abnormalities. Two predominant isoforms and a number of minor isoforms are produced by alternatively spliced transcripts. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (9) lacks several alternate in-frame exons, compared to variant 1. The resulting protein (isoform 8, also referred to as isoform Mer162) is shorter than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214514 | NF2 (Myc-DDK-tagged)-Human neurofibromin 2 (merlin) (NF2), transcript variant 9 |
CNY 3,990.00 |
|
| RC214514L3 | Lenti-ORF clone of NF2 (Myc-DDK-tagged)-Human neurofibromin 2 (merlin) (NF2), transcript variant 9 |
CNY 5,890.00 |
|
| RC214514L4 | Lenti-ORF clone of NF2 (mGFP-tagged)-Human neurofibromin 2 (merlin) (NF2), transcript variant 9 |
CNY 5,890.00 |
|
| RG214514 | NF2 (tGFP-tagged) - Human neurofibromin 2 (merlin) (NF2), transcript variant 9 |
CNY 2,920.00 |
