United States
Germany
Japan
United Kingdom
China
CD89 (FCAR) (NM_133278) Human Untagged Clone
CAT＃: SC309498
FCAR (untagged)-Human Fc fragment of IgA, receptor for (FCAR), transcript variant 8
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CD89; CTB-61M7.2; FcalphaRI |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_133278, the custom clone sequence may differ by one or more nucleotides
ATGGACCCCAAACAGACCACCCTCCTGTGTCTTGGGGACTTTCCCATGCCTTTCATATCT GCCAAATCGAGTCCTGTGATTCCCTTGGATGGATCTGTGAAAATCCAGTGCCAGGCCATT CGTGAAGCTTACCTGACCCAGCTGATGATCATAAAAAACTCCACGTACCGAGAGATAGGC AGAAGACTGAAGTTTTGGAATGAGACTGATCCTGAGTTCGTCATTGACCACATGGACGCA AACAAGGCAGGGCGCTATCAGTGCCAATATAGGATAGGGCACTACAGATTCCGGTACAGT GACACCCTGGAGCTGGTAGTGACAGGCTTGTATGGCAAACCCTTCCTCTCTGCAGATCGG GGTCTGGTGTTGATGCCAGGAGAGAATATTTCCCTCACGTGCAGCTCAGCACACATCCCA TTTGATAGATTTTCACTGGCCAAGGAGGGAGAACTTTCTCTGCCACAGCACCAAAGTGGG GAACACCCGGCCAACTTCTCTTTGGGTCCTGTGGACCTCAATGTCTCAGGGATCTACAGG TGCTACGACTCCATCCACCAAGATTACACGACGCAGAACTTGATCCGCATGGCCGTGGCA GGACTGGTCCTCGTGGCTCTCTTGGCCATACTGGTTGAAAATTGGCACAGCCATACGGCA CTGAACAAGGAAGCCTCGGCAGATGTGGCTGAACCGAGCTGGAGCCAACAGATGTGTCAG CCAGGATTGACCTTTGCACGAACACCAAGTGTCTGCAAGTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_133278 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_133278.1, NP_579812.1 |
| RefSeq Size | 1569 bp |
| RefSeq ORF | 1569 bp |
| Locus ID | 2204 |
| UniProt ID | P24071 |
| Protein Families | Transmembrane |
| Gene Summary | This gene is a member of the immunoglobulin gene superfamily and encodes a receptor for the Fc region of IgA. The receptor is a transmembrane glycoprotein present on the surface of myeloid lineage cells such as neutrophils, monocytes, macrophages, and eosinophils, where it mediates immunologic responses to pathogens. It interacts with IgA-opsonized targets and triggers several immunologic defense processes, including phagocytosis, antibody-dependent cell-mediated cytotoxicity, and stimulation of the release of inflammatory mediators. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (8, also known as deltaS266Ec2 or U13) lacks an in-frame exon in the 5' coding region and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (h) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214590 | FCAR (Myc-DDK-tagged)-Human Fc fragment of IgA, receptor for (FCAR), transcript variant 8 |
CNY 3,990.00 |
|
| RC214590L3 | Lenti-ORF clone of FCAR (Myc-DDK-tagged)-Human Fc fragment of IgA, receptor for (FCAR), transcript variant 8 |
CNY 5,890.00 |
|
| RC214590L4 | Lenti-ORF clone of FCAR (mGFP-tagged)-Human Fc fragment of IgA, receptor for (FCAR), transcript variant 8 |
CNY 5,890.00 |
|
| RG214590 | FCAR (tGFP-tagged) - Human Fc fragment of IgA, receptor for (FCAR), transcript variant 8 |
CNY 4,370.00 |
