United States
Germany
Japan
United Kingdom
China
Ephrin A4 (EFNA4) (NM_182689) Human Untagged Clone
CAT＃: SC309494
EFNA4 (untagged)-Human ephrin-A4 (EFNA4), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | EFL4; EPLG4; LERK4 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_182689, the custom clone sequence may differ by one or more nucleotides
ATGCGGCTGCTGCCCCTGCTGCGGACTGTCCTCTGGGCCGCGTTCCTCGGCTCCCCTCTG CGCGGGGGCTCCAGCCTCCGCCACGTAGTCTACTGGAACTCCAGTAACCCCAGGTTGCTT CGAGGAGACGCCGTGGTGGAGCTGGGCCTCAACGATTACCTAGACATTGTCTGCCCCCAC TACGAAGGCCCAGGGCCCCCTGAGGGCCCCGAGACGTTTGCTTTGTACATGGTGGACTGG CCAGGCTATGAGTCCTGCCAGGCAGAGGGCCCCCGGGCCTACAAGCGCTGGGTGTGCTCC CTGCCCTTTGGCCATGTTCAATTCTCAGAGAAGATTCAGCGCTTCACACCCTTCTCCCTC GGCTTTGAGTTCTTACCTGGAGAGACTTACTACTACATCTCGGTGCCCACTCCAGAGAGT TCTGGCCAGTGCTTGAGGCTCCAGGTGTCTGTCTGCTGCAAGGAGAGGAGAGCCAGAGTC CTCCCAAGATCCCCTGGAGGAGGAGGGATCCCTGCTGCCTGCACTGGGGGTGCCAATTCA GACCGACAAGATGGAGCATTGATGGGGGAGATCAGAGGGTCTGAGGTGACTCTTGCAGGA GCCTGTCCCCTCATCACAGGCTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_182689 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_182689.1, NP_872631.1 |
| RefSeq Size | 1110 bp |
| RefSeq ORF | 624 bp |
| Locus ID | 1945 |
| UniProt ID | P52798 |
| Protein Families | Secreted Protein |
| Protein Pathways | Axon guidance |
| Gene Summary | This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNA class ephrin. Three transcript variants that encode distinct proteins have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1, that results in a downstream translation termination. It encodes isoform b which has a little longer and distinct C-terminus compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215216 | EFNA4 (Myc-DDK-tagged)-Human ephrin-A4 (EFNA4), transcript variant 2 |
CNY 3,990.00 |
|
| RC215216L3 | Lenti-ORF clone of EFNA4 (Myc-DDK-tagged)-Human ephrin-A4 (EFNA4), transcript variant 2 |
CNY 5,890.00 |
|
| RC215216L4 | Lenti-ORF clone of EFNA4 (mGFP-tagged)-Human ephrin-A4 (EFNA4), transcript variant 2 |
CNY 5,890.00 |
|
| RG215216 | EFNA4 (tGFP-tagged) - Human ephrin-A4 (EFNA4), transcript variant 2 |
CNY 4,370.00 |
其它Ephrin A4产品
