Cathepsin E (CTSE) (NM_148964) Human Untagged Clone

CAT#: SC309487

CTSE (untagged)-Human cathepsin E (CTSE), transcript variant 2



  "NM_148964" in other vectors (4)

CNY 5,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-CTSE Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CATE
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC309487 representing NM_148964.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAAACGCTCCTTCTTTTGCTGCTGGTGCTCCTGGAGCTGGGAGAGGCCCAAGGATCCCTTCACAGG
GTGCCCCTCAGGAGGCATCCGTCCCTCAAGAAGAAGCTGCGGGCACGGAGCCAGCTCTCTGAGTTCTGG
AAATCCCATAATTTGGACATGATCCAGTTCACCGAGTCCTGCTCAATGGACCAGAGTGCCAAGGAACCC
CTCATCAACTACTTGGATATGGAATACTTCGGCACTATCTCCATTGGCTCCCCACCACAGAACTTCACT
GTCATCTTCGACACTGGCTCCTCCAACCTCTGGGTCCCCTCTGTGTACTGCACTAGCCCAGCCTGCAAG
ACGCACAGCAGGTTCCAGCCTTCCCAGTCCAGCACATACAGCCAGCCAGGTCAATCTTTCTCCATTCAG
TATGGAACCGGGAGCTTGTCCGGGATCATTGGAGCCGACCAAGTCTCTGTGGAAGGACTAACCGTGGTT
GGCCAGCAGTTTGGAGAAAGTGTCACAGAGCCAGGCCAGACCTTTGTGGATGCAGAGTTTGATGGAATT
CTGGGCCTGGGATACCCCTCCTTGGCTGTGGGAGGAGTGACTCCAGTATTTGACAACATGATGGCTCAG
AACCTGGTGGACTTGCCGATGTTTTCTGTCTACATGAGCAGTAACCCAGAAGGTGGTGCGGGGAGCGAG
CTGATTTTTGGAGGCTACGACCACTCCCATTTCTCTGGGAGCCTGAATTGGGTCCCAGTCACCAAGCAA
GCTTACTGGCAGATTGCACTGGATAATATGCTGTGGAGTGTGCCAACCTTAACGTCATGCCGGATGTCA
CCTTCACCATTAACGGAGTCCCCTATACCCTCAGCCCAACTGCCTACACCCTACTGGACTTCGTGGATG
GAATGCAGTTCTGCAGCAGTGGCTTTCAAGGACTTGACATCCACCCTCCAGCTGGGCCCCTCTGGATCC
TGGGGGATGTCTTCATTCGACAGTTTTACTCAGTCTTTGACCGTGGGAATAACCGTGTGGGACTGGCCC
CAGCAGTCCCCTAAGGAGGGGCCTTGTGTCTGTGCCTGCCTGTCTGACAGACCTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_148964
Insert Size 1092 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_148964.2
RefSeq Size 2180 bp
RefSeq ORF 1092 bp
Locus ID 1510
UniProt ID P14091
Protein Families Druggable Genome, Protease
Protein Pathways Lysosome
MW 39.6 kDa
Gene Summary This gene encodes a member of the A1 family of peptidases. Alternative splicing of this gene results in multiple transcript variants. At least one of these variants encodes a preproprotein that is proteolytically processed to generate the mature enzyme. This enzyme, an aspartic endopeptidase, may be involved in antigen processing and the maturation of secretory proteins. Elevated expression of this gene has been observed in neurodegeneration. [provided by RefSeq, Nov 2015]
Transcript Variant: This variant (2) lacks an alternate exon in the 3' coding region resulting in a frameshift compared to variant 1. The encoded isoform (b) is shorter and has a distinct C-terminus compared to isoform a. This isoform (b) may undergo proteolytic processing but exhibits reduced enzymatic activity compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...