BDNF (NM_170735) Human Untagged Clone
CAT#: SC309453
BDNF (untagged)-Human brain-derived neurotrophic factor (BDNF), transcript variant 1
CNY 3,600.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ANON2; BULN2 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_170735, the custom clone sequence may differ by one or more nucleotides
ATGACCATCCTTTTCCTTACTATGGTTATTTCATACTTTGGTTGCATGAAGGCTGCCCCCATGAAAGAAG CAAACATCCGAGGACAAGGTGGCTTGGCCTACCCAGGTGTGCGGACCCATGGGACTCTGGAGAGCGTGAA TGGGCCCAAGGCAGGTTCAAGAGGCTTGACATCATTGGCTGACACTTTCGAACACGTGATAGAAGAGCTG TTGGATGAGGACCAGAAAGTTCGGCCCAATGAAGAAAACAATAAGGACGCAGACTTGTACACGTCCAGGG TGATGCTCAGTAGTCAAGTGCCTTTGGAGCCTCCTCTTCTCTTTCTGCTGGAGGAATACAAAAATTACCT AGATGCTGCAAACATGTCCATGAGGGTCCGGCGCCACTCTGACCCTGCCCGCCGAGGGGAGCTGAGCGTG TGTGACAGTATTAGTGAGTGGGTAACGGCGGCAGACAAAAAGACTGCAGTGGACATGTCGGGCGGGACGG TCACAGTCCTTGAAAAGGTCCCTGTATCAAAAGGCCAACTGAAGCAATACTTCTACGAGACCAAGTGCAA TCCCATGGGTTACACAAAAGAAGGCTGCAGGGGCATAGACAAAAGGCATTGGAACTCCCAGTGCCGAACT ACCCAGTCGTACGTGCGGGCCCTTACCATGGATAGCAAAAAGAGAATTGGCTGGCGATTCATAAGGATAG ACACTTCTTGTGTATGTACATTGACCATTAAAAGGGGAAGATAG |
Restriction Sites | NotI-NotI |
ACCN | NM_170735 |
Insert Size | 1300 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_170735.4, NP_733931.1 |
RefSeq Size | 4247 bp |
RefSeq ORF | 744 bp |
Locus ID | 627 |
UniProt ID | P23560 |
Protein Families | Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Secreted Protein, Transmembrane |
Protein Pathways | Huntington's disease, MAPK signaling pathway, Neurotrophin signaling pathway |
Gene Summary | This gene encodes a member of the nerve growth factor family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protein. Binding of this protein to its cognate receptor promotes neuronal survival in the adult brain. Expression of this gene is reduced in Alzheimer's, Parkinson's, and Huntington's disease patients. This gene may play a role in the regulation of the stress response and in the biology of mood disorders. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (1), also known as IX, represents the longest transcript. Variants 1, 2, 4, 5, and 7-16 encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217190 | BDNF (Myc-DDK-tagged)-Human brain-derived neurotrophic factor (BDNF), transcript variant 1 |
CNY 3,600.00 |
|
RC217190L1 | Lenti ORF clone of Human brain-derived neurotrophic factor (BDNF), transcript variant 1, Myc-DDK-tagged |
CNY 6,000.00 |
|
RC217190L2 | Lenti ORF clone of Human brain-derived neurotrophic factor (BDNF), transcript variant 1, mGFP tagged |
CNY 6,000.00 |
|
RC217190L3 | Lenti ORF clone of Human brain-derived neurotrophic factor (BDNF), transcript variant 1, Myc-DDK-tagged |
CNY 6,000.00 |
|
RC217190L4 | Lenti ORF clone of Human brain-derived neurotrophic factor (BDNF), transcript variant 1, mGFP tagged |
CNY 6,000.00 |
|
RG217190 | BDNF (tGFP-tagged) - Human brain-derived neurotrophic factor (BDNF), transcript variant 1 |
CNY 5,200.00 |