CD95 (FAS) (NM_152871) Human Untagged Clone

CAT#: SC309140

FAS (untagged)-Human Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 2



  "NM_152871" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


FAS mouse monoclonal antibody, clone OTI2C2 (formerly 2C2)
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ALPS1A; APO-1; APT1; CD95; FAS1; FASTM; TNFRSF6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC309140 representing NM_152871.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGGGCATCTGGACCCTCCTACCTCTGGTTCTTACGTCTGTTGCTAGATTATCGTCCAAAAGTGTT
AATGCCCAAGTGACTGACATCAACTCCAAGGGATTGGAATTGAGGAAGACTGTTACTACAGTTGAGACT
CAGAACTTGGAAGGCCTGCATCATGATGGCCAATTCTGCCATAAGCCCTGTCCTCCAGGTGAAAGGAAA
GCTAGGGACTGCACAGTCAATGGGGATGAACCAGACTGCGTGCCCTGCCAAGAAGGGAAGGAGTACACA
GACAAAGCCCATTTTTCTTCCAAATGCAGAAGATGTAGATTGTGTGATGAAGGACATGGCTTAGAAGTG
GAAATAAACTGCACCCGGACCCAGAATACCAAGTGCAGATGTAAACCAAACTTTTTTTGTAACTCTACT
GTATGTGAACACTGTGACCCTTGCACCAAATGTGAACATGGAATCATCAAGGAATGCACACTCACCAGC
AACACCAAGTGCAAAGAGGAAGTGAAGAGAAAGGAAGTACAGAAAACATGCAGAAAGCACAGAAAGGAA
AACCAAGGTTCTCATGAATCTCCAACTTTAAATCCTGAAACAGTGGCAATAAATTTATCTGATGTTGAC
TTGAGTAAATATATCACCACTATTGCTGGAGTCATGACACTAAGTCAAGTTAAAGGCTTTGTTCGAAAG
AATGGTGTCAATGAAGCCAAAATAGATGAGATCAAGAATGACAATGTCCAAGACACAGCAGAACAGAAA
GTTCAACTGCTTCGTAATTGGCATCAACTTCATGGAAAGAAAGAAGCGTATGACACATTGATTAAAGAT
CTCAAAAAAGCCAATCTTTGTACTCTTGCAGAGAAAATTCAGACTATCATCCTCAAGGACATTACTAGT
GACTCAGAAAATTCAAACTTCAGAAATGAAATCCAAAGCTTGGTCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_152871
Insert Size 945 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_152871.3
RefSeq Size 3888 bp
RefSeq ORF 945 bp
Locus ID 355
UniProt ID P25445
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein
Protein Pathways Allograft rejection, Alzheimer's disease, Apoptosis, Autoimmune thyroid disease, Cytokine-cytokine receptor interaction, Graft-versus-host disease, MAPK signaling pathway, Natural killer cell mediated cytotoxicity, p53 signaling pathway, Pathways in cancer, Type I diabetes mellitus
MW 35.4 kDa
Gene Summary The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contains a death domain. It has been shown to play a central role in the physiological regulation of programmed cell death, and has been implicated in the pathogenesis of various malignancies and diseases of the immune system. The interaction of this receptor with its ligand allows the formation of a death-inducing signaling complex that includes Fas-associated death domain protein (FADD), caspase 8, and caspase 10. The autoproteolytic processing of the caspases in the complex triggers a downstream caspase cascade, and leads to apoptosis. This receptor has been also shown to activate NF-kappaB, MAPK3/ERK1, and MAPK8/JNK, and is found to be involved in transducing the proliferating signals in normal diploid fibroblast and T cells. Several alternatively spliced transcript variants have been described, some of which are candidates for nonsense-mediated mRNA decay (NMD). The isoforms lacking the transmembrane domain may negatively regulate the apoptosis mediated by the full length isoform. [provided by RefSeq, Mar 2011]
Transcript Variant: This variant (2), also known as FasdeltaTM or soluble FAS, lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. The resulting isoform (2) lacks an internal region, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...